989 resultados para Newell, Jonathan, 1749-1830.
Resumo:
Mode of access: Internet.
Resumo:
The form of name which Alvear used was: Carlos María de Alvear. His certificate of baptism, which was found after his death, gives as his baptismal name: Carlos Antonio Josef Gabino del Angel de la Guardia. cf. v.1, p. [49]-50.
Resumo:
Mode of access: Internet.
Resumo:
Mode of access: Internet.
Resumo:
In Scrittori classici italiani di economia politica. Milano, 1804. 22 cm. v.36, p.[7]-249.
Resumo:
Includes bibliographical references.
Resumo:
Buff printed paper cover has title: Mr. Young's address at the ordination of the Rev. William Newell.
Resumo:
Survey map and description of Jonathan Silverthorn's land created by The Welland Canal Company. Included is a written description of the land along with a drawing of the land. The lands surveyed include lots 229 and 230. The land was first surveyed in 1830, then again in 1834, by George Keefer. The original survey only included the feeder and resevoir and wood land, whereas the second survey shows all lands owned by Silverthorn. The land totals 19.2 acres, 2 roads and 32 perches. The land is broken down as follows; 7.6 acres cleared land, canal and towpath, 6.6 acres reservoir - Michael Silverthorn, 5 acres woodland. Surveyor notes are seen in pencil and red pen on the map.See also page 138.
Resumo:
Two letters on topics such as Mason’s search for original documents relating to the Constitution and the admission of Missouri to the union as a slave state.
Resumo:
Two letters expressing condolences for the death of the elder William Tudor and thanking Tudor for his concern over an unnamed affliction of McCauley. McCauley also includes in both letters bank drafts for Delia Tudor Stewart.
Resumo:
This layer is a georeferenced raster image of the historic paper map entitled: A plan of Bellingham, Norfolk County, Mass., surveyed by Newell Nelson in Augt. & Sepr. 1830. It was published by Pendleton's Lithography. Scale [1:19,800]. The image inside the map neatline is georeferenced to the surface of the earth and fit to the Massachusetts State Plane Coordinate System, Mainland Zone (in Feet) (Fipszone 2001). All map collar and inset information is also available as part of the raster image, including any inset maps, profiles, statistical tables, directories, text, illustrations, or other information associated with the principal map. This map shows features such as roads, drainage, public buildings, schools, churches, cemeteries, industry locations (e.g. mills, factories, mines, etc.), private buildings with names of property owners, town boundaries and more. Relief is shown by hachures. This layer is part of a selection of digitally scanned and georeferenced historic maps of Massachusetts from the Harvard Map Collection. These maps typically portray both natural and manmade features. The selection represents a range of regions, originators, ground condition dates (1755-1922), scales, and purposes. The digitized selection includes maps of: the state, Massachusetts counties, town surveys, coastal features, real property, parks, cemeteries, railroads, roads, public works projects, etc.
Resumo:
Mode of access: Internet.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.