Polygraph Protection Act of 1985 [microform] : hearing before the Committee on Labor and Human Resources, United States Senate, Ninety-ninth Congress, second session on S. 1815 ... April 23, 1986.

CIS Microfiche Accession Numbers: CIS 86 S541-62

Scientific validity of polygraph testing : a research review and evaluation.

Mode of access: Internet.

The Illinois Detection of Deception Examiners Act.

Description based on: 1985; title from cover.

Polygraph examinations.

Cover title.

Comparison of Local Feature Detectors and Descriptors for Visual Object Categorization

Local features are used in many computer vision tasks including visual object categorization, content-based image retrieval and object recognition to mention a few. Local features are points, blobs or regions in images that are extracted using a local feature detector. To make use of extracted local features the localized interest points are described using a local feature descriptor. A descriptor histogram vector is a compact representation of an image and can be used for searching and matching images in databases. In this thesis the performance of local feature detectors and descriptors is evaluated for object class detection task. Features are extracted from image samples belonging to several object classes. Matching features are then searched using random image pairs of a same class. The goal of this thesis is to find out what are the best detector and descriptor methods for such task in terms of detector repeatability and descriptor matching rate.

Monte Carlo Simulations of Novel Scintillator Detectors and Dosimetry Calculations

Monte Carlo (MC) simulation techniques are becoming very common in the Medical Physicists community. MC can be used for modeling Single Photon Emission Computed Tomography (SPECT) and for dosimetry calculations. 188Re, is a promising candidate for radiotherapeutic production and understanding the mechanisms of the radioresponse of tumor cells "in vitro" is of crucial importance as a first step before "in vivo" studies. The dosimetry of 188Re, used to target different lines of cancer cells, has been evaluated by the MC code GEANT4. The simulations estimate the average energy deposition/per event in the biological samples. The development of prototypes for medical imaging, based on LaBr3:Ce scintillation crystals coupled with a position sensitive photomultiplier, have been studied using GEANT4 simulations. Having tested, in the simulation, surface treatments different from the one applied to the crystal used in our experimental measurements, we found out that the Energy Resolution (ER) and the Spatial Resolution (SR) could be improved, in principle, by machining in a different way the lateral surfaces of the crystal. We have then studied a system able to acquire both echographic and scintigraphic images to let the medical operator obtain the complete anatomic and functional information for tumor diagnosis. The scintigraphic part of the detector is simulated by GEANT4 and first attempts to reconstruct tomographic images have been made using as method of reconstruction a back-projection standard algorithm. The proposed camera is based on slant collimators and LaBr3:Ce crystals. Within the Field of View (FOV) of the camera, it possible to distinguish point sources located in air at a distance of about 2 cm from each other. In particular conditions of uptake, tumor depth and dimension, the preliminary results show that the Signal to Noise Ratio (SNR) values obtained are higher than the standard detection limit.

Improved sampling, pre-concentration, and detection of hidden explosives and illicit drugs by a novel solid phase microextraction geometry coupled to ion mobility spectrometry

The 9/11 Act mandates the inspection of 100% of cargo shipments entering the U.S. by 2012 and 100% inspection of air cargo by March 2010. So far, only 5% of inbound shipping containers are inspected thoroughly while air cargo inspections have fared better at 50%. Government officials have admitted that these milestones cannot be met since the appropriate technology does not exist. This research presents a novel planar solid phase microextraction (PSPME) device with enhanced surface area and capacity for collection of the volatile chemical signatures in air that are emitted from illicit compounds for direct introduction into ion mobility spectrometers (IMS) for detection. These IMS detectors are widely used to detect particles of illicit substances and do not have to be adapted specifically to this technology. For static extractions, PDMS and sol-gel PDMS PSPME devices provide significant increases in sensitivity over conventional fiber SPME. Results show a 50–400 times increase in mass detected of piperonal and a 2–4 times increase for TNT. In a blind study of 6 cases suspected to contain varying amounts of MDMA, PSPME-IMS correctly detected 5 positive cases with no false positives or negatives. One of these cases had minimal amounts of MDMA resulting in a false negative response for fiber SPME-IMS. A La (dihed) phase chemistry has shown an increase in the extraction efficiency of TNT and 2,4-DNT and enhanced retention over time. An alternative PSPME device was also developed for the rapid (seconds) dynamic sampling and preconcentration of large volumes of air for direct thermal desorption into an IMS. This device affords high extraction efficiencies due to strong retention properties under ambient conditions resulting in ppt detection limits when 3.5 L of air are sampled over the course of 10 seconds. Dynamic PSPME was used to sample the headspace over the following: MDMA tablets (12–40 ng detected of piperonal), high explosives (Pentolite) (0.6 ng detected of TNT), and several smokeless powders (26–35 ng of 2,4-DNT and 11–74 ng DPA detected). PSPME-IMS technology is flexible to end-user needs, is low-cost, rapid, sensitive, easy to use, easy to implement, and effective. ^

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Characterization of a microcystin and detection of microcystin synthetase genes from a Brazilian isolate of Nostoc

A nostocalean nitrogen-fixing cyanobacterium isolated from an eutrophic freshwater reservoir located in Piracicaba, Sao Paulo, Brazil, was evaluated for the production of hepatotoxic cyclic heptapeptides, microcystins. Morphologically this new cyanobacterium strain appears closest to Nostoc, however, in the phylogenetic analysis of 165 rRNA gene it falls into a highly stable cluster distantly only related to the typical Nostoc cluster. Extracts of Nostoc sp. CENA88 cultured cells, investigated using ELISA assay, gave positive results and the microcystin profile revealed by ESI-Q-TOF/MS/MS analysis confirmed the production of [Dha(7)]MCYST-YR. Further, Nostoc sp. CENA88 genomic DNA was analyzed by PCR for sequences of mcyD, mcyE and mcyG genes of microcystin synthetase (mcy) cluster. The result revealed the presence of mcyD, mcyE and mcyG genes with similarities to those from mcy of Nostoc sp. strains 152 and IO-102-I and other cyanobacterial genera. The phylogenetic tree based on concatenated McyG, McyD and McyE amino acids clustered the sequences according to cyanobacterial genera, with exception of the Nostoc sp. CENA88 sequence, which was placed in a clade distantly related from other Nostoc strains, as previously observed also in the 165 rRNA phylogenetic analysis. The present study describes for the first time a Brazilian Nostoc microcystin producer and also the occurrence of demethyl MCYST-YR variant in this genus. The sequenced Nostoc genes involved in the microcystin synthesis can contribute to a better understanding of the toxigenicity and evolution of this cyanotoxin. (C) 2009 Elsevier Ltd. All rights reserved.

Myocarditis in children and detection of viruses in myocardial tissue: Implications for immunosuppressive therapy

Background: There is scarce information on the potential benefits of immunosuppression in children with myocarditis and viral genomes in myocardium. We investigated the occurrence of myocarditis in children with a preliminary diagnosis of dilated cardiomyopathy, the frequency of cardiotropic viruses in the myocardium, and the response to immunosuppression. Methods: Thirty patients (nine months to 12 years) with left ventricular ejection fraction of 22.8 +/- 4.1% were subjected to right cardiac catheterization and endomyocardial biopsy. Specimens were analyzed for the presence of inflammatory elements (Dallas criteria) and viral genome (polymerase chain reaction). Patients with active myocarditis received immunosuppressants (azatioprine and prednisone) and were recatheterized nine months later. A historical control group of nine patients with myocarditis who did not receive immunosuppressants was included. Results: Active myocarditis was diagnosed in ten patients (five with viral genomes detected). Immunosuppression resulted in a significant increase in left ventricular ejection fraction from 25.2 +/- 2.8% to 45.7 +/- 8.6% (versus 20.0 +/- 4.0% to 22.0 +/- 9.0% in historical controls, p < 0.01) and cardiac index from 3.28 +/- 0.51 L/min/m(2) to 4.40 +/- 0.49 L/min/m(2) (versus 3.50 +/- 0.40 L/min/m(2) to 3.70 +/- 0.50 L/min/m(2) in controls, p < 0.01), regardless of the presence of viral genomes (p - 0.98 and p - 0.22, respectively for the two variables). No relevant clinical events were observed. Non-inflammatory cardiomyopathy was diagnosed in 20 patients (seven with viral genomes). While on conventional therapy, there were four deaths and three assignments to transplantation, and no improvement of left ventricular ejection fraction in the remaining ones (22.5 +/- 3.6% to 27.5 +/- 10.6%). Conclusion: Children with chronic myocarditis seem to benefit from immunosuppressive therapy, regardless of the presence of viral genome in the myocardium. (C) 2009 Elsevier Ireland Ltd. All rights reserved.

Single side damage simulations and detection in beam-like structures

Beam-like structures are the most common components in real engineering, while single side damage is often encountered. In this study, a numerical analysis of single side damage in a free-free beam is analysed with three different finite element models; namely solid, shell and beam models for demonstrating their performance in simulating real structures. Similar to experiment, damage is introduced into one side of the beam, and natural frequencies are extracted from the simulations and compared with experimental and analytical results. Mode shapes are also analysed with modal assurance criterion. The results from simulations reveal a good performance of the three models in extracting natural frequencies, and solid model performs better than shell while shell model performs better than beam model under intact state. For damaged states, the natural frequencies captured from solid model show more sensitivity to damage severity than shell model and shell model performs similar to the beam model in distinguishing damage. The main contribution of this paper is to perform a comparison between three finite element models and experimental data as well as analytical solutions. The finite element results show a relatively well performance.

Difficulties in the diagnosis of HTLV-2 infection in HIV/AIDS patients from Brazil: comparative performances of serologic and molecular assays, and detection of HTLV-2b subtype

The current diagnosis of human T-lymphotropic virus type-2 (HTLV-2) infection is based on the search of specific antibodies; nevertheless, several studies conducted in Brazil pointed deficiencies of the commercially available kits in detecting HTLV-2, mostly in HIV/AIDS patients. This study searched for the presence of HTLV-1 and -2 in 758 HIV/AIDS patients from Londrina, Paraná, Brazil. Serum samples were screened for HTLV-1/2 antibodies using two EIA kits (Vironostika and Murex), and confirmed by WB (HTLV Blot 2.4, Genelabs). The results obtained by EIA disclosed 49 (6.5%) reactive sera: 43 positive by both EIA kits, and six with discordant results. WB confirmed HTLV-1 infection in seven samples (0.9%) and HTLV-2 in 21 sera (2.8%). Negative and indeterminate results were detected in four (0.5%) and 16 (2.1%) sera, respectively. Blood from 47 out of 49 HTLV seroreactive patients were collected and analyzed for the presence of env, LTR and tax genomic segments of HTLVs by PCR. PCR confirmed six cases of HTLV-1 and 37 cases of HTLV-2 infection (14 out of 16 that were found to be WB indeterminate). Restriction analysis of the env PCR products of HTLV-2 disclosed 36 isolates of HTLV-2a/c subtype, and one of HTLV-2b subtype. These results emphasize the need of improving serologic tests for detecting truly HTLV-2 infected patients from Brazil, and confirm the presence of HTLV-2b subtype in the South of this country.

The use of saliva as a practical and feasible alternative to urine in large-scale screening for congenital cytomegalovirus infection increasesinclusion and detection rates

INTRODUCTION: Although urine is considered the gold-standard material for the detection of congenital cytomegalovirus (CMV) infection, it can be difficult to obtain in newborns. The aim of this study was to compare the efficiency of detection of congenital CMV infection in saliva and urine samples. METHODS: One thousand newborns were included in the study. Congenital cytomegalovirus deoxyribonucleic acid (DNA) was detected by polymerase chain reaction (PCR). RESULTS: Saliva samples were obtained from all the newborns, whereas urine collection was successful in only 333 cases. There was no statistically significant difference between the use of saliva alone or saliva and urine collected simultaneously for the detection of CMV infection. CONCLUSIONS: Saliva samples can be used in large-scale neonatal screening for CMV infection.