Nominations of Shirley Chilton-ODell and Stephen L. Norris : hearing before the Committee on Governmental Affairs, United States Senate, One Hundred Second Congress, second session, on nominations of Shirley Chilton-ODell and Stephen L. Norris, to be members of Federal Retirement Thrift Investment Board, September 18, 1992.

Shipping list no.: 93-0242-P.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Alignment of the CMS tracker with LHC and cosmic ray data

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

1923 University of Michigan Baseball Team (full Squad)

Top Row: John Shackleford, Harry Kipke, George Dillman, Rudy Ash, coach Ray Fisher, Merle Baker?, William Giles, Leonard Van Boven, Edliff Slaughter, Howard Liverance

Front Row: Jerry Benson, Jack Blott, George Haggerty, Meyer Paper, Irwin Uteritz, Robert Knode, Adolph Klein, Leo Coleman, Vernon Swanson

Ethnic differences in the BMI-%BF relationships between young Japanese and Australian-Caucasian males living in Australia using dual-energy X-ray absorptiometry

The Body Mass Index (BMI) has been used worldwide as an indicator of fatness. However, the universal cut-off points by the World Health Organisation (WHO) classification may not be appropriate for every ethnic group when consider the relationship with their actual total body fatness(%BF). The application of population-specific classifications to assess BMI may be more relevant to public health. Ethnic differences in the BMI%BF relationship between 45 Japanese and 42 Australian-Caucasian males were assessed using whole body dual-energy X-ray absorptiometry (DXA) scan and anthropometry using a standard protocol. Japanese males had significantly (p<0.05) greater %BF at given BMI values than Australian males. When this is taken into account the newly proposed Asia-Pacific BMI classification of BMI 23 as overweight and 25 as obese may better assess the level of obesity that is associated increased health risks for this population. To clarify the current findings, further studies that compare the relationships across other Japanese populations are recommended.

X-ray your data with Rasch

By using the Rasch model, much detailed diagnostic information is available to developers of survey and assessment instruments and to the researchers who use them. We outline an approach to the analysis of data obtained from the administration of survey instruments that can enable researchers to recognise and diagnose difficulties with those instruments and then to suggest remedial actions that can improve the measurement properties of the scales included in questionnaires. We illustrate the approach using examples drawn from recent research and demonstrate how the approach can be used to generate figures that make the results of Rasch analyses accessible to non-specialists.

3-D reconstruction of an ancient Egyptian mummy using X-ray computer tomography

Computer tomography has been used to image and reconstruct in 3-D an Egyptian mummy from the collection of the British Museum. This study of Tjentmutengebtiu, a priestess from the 22nd dynasty (945-715 BC) revealed invaluable information of a scientific, Egyptological and palaeopathological nature without mutilation and destruction of the painted cartonnage case or linen wrappings. Precise details on the removal of the brain through the nasal cavity and the viscera from the abdominal cavity were obtained. The nature and composition of the false eyes were investigated. The detailed analysis of the teeth provided a much closer approximation of age at death. The identification of materials used for the various amulets including that of the figures placed in the viscera was graphically demonstrated using this technique.

X-ray computed tomography

X-ray computed tomography (CT) is a medical imaging technique that produces images of trans-axial planes through the human body. When compared with a conventional radiograph, which is an image of many planes superimposed on each other, a CT image exhibits significantly improved contrast although this is at the expense of reduced spatial resolution.----- A CT image is reconstructed mathematically from a large number of one dimensional projections of the chosen plane. These projections are acquired electronically using a linear array of solid-state detectors and an x ray source that rotates around the patient.----- X-ray computed tomography is used routinely in radiological examinations. It has also be found to be useful in special applications such as radiotherapy treatment planning and three-dimensional imaging for surgical planning.

Smectite flocculation structure modified by AI13 macromolecules; as revealed by the Transmission X-ray Microscopy (TXM)

The aggregate structure which occurs in aqueous smectitic suspensions is responsible for poor water clarification, difficulties in sludge dewatering and the unusual rheological behaviour of smectite rich soils. These macroscopic properties are dictated by the 3-D structural arrangement of smectite finest fraction within flocculated aggregates. Here, we report results from a relatively new technique, Transmission X-ray Microscopy (TXM), which makes it possible to investigate the internal structure and 3-D tomographic reconstruction of the smectite clay aggregates modified by Al13 keggin macro-molecule [Al13(O)4(OH)24(H2O)12 ]7+. Three different treatment methods were shown resulted in three different micro-structural environments of the resulting flocculation.