12 resultados para overlapping community detection

em Reposit


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mine drainage is an important environmental disturbance that affects the chemical and biological components in natural resources. However, little is known about the effects of neutral mine drainage on the soil bacteria community. Here, a high-throughput 16S rDNA pyrosequencing approach was used to evaluate differences in composition, structure, and diversity of bacteria communities in samples from a neutral drainage channel, and soil next to the channel, at the Sossego copper mine in Brazil. Advanced statistical analyses were used to explore the relationships between the biological and chemical data. The results showed that the neutral mine drainage caused changes in the composition and structure of the microbial community, but not in its diversity. The Deinococcus/Thermus phylum, especially the Meiothermus genus, was in large part responsible for the differences between the communities, and was positively associated with the presence of copper and other heavy metals in the environmental samples. Other important parameters that influenced the bacterial diversity and composition were the elements potassium, sodium, nickel, and zinc, as well as pH. The findings contribute to the understanding of bacterial diversity in soils impacted by neutral mine drainage, and demonstrate that heavy metals play an important role in shaping the microbial population in mine environments.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work the archaea and eubacteria community of a hypersaline produced water from the Campos Basin that had been transported and discharged to an onshore storage facility was evaluated by 16S recombinant RNA (rRNA) gene sequence analysis. The produced water had a hypersaline salt content of 10 (w/v), had a carbon oxygen demand (COD) of 4,300 mg/l and contains phenol and other aromatic compounds. The high salt and COD content and the presence of toxic phenolic compounds present a problem for conventional discharge to open seawater. In previous studies, we demonstrated that the COD and phenolic content could be largely removed under aerobic conditions, without dilution, by either addition of phenol degrading Haloarchaea or the addition of nutrients alone. In this study our goal was to characterize the microbial community to gain further insight into the persistence of reservoir community members in the produced water and the potential for bioremediation of COD and toxic contaminants. Members of the archaea community were consistent with previously identified communities from mesothermic reservoirs. All identified archaea were located within the phylum Euryarchaeota, with 98 % being identified as methanogens while 2 % could not be affiliated with any known genus. Of the identified archaea, 37 % were identified as members of the strictly carbon-dioxide-reducing genus Methanoplanus and 59 % as members of the acetoclastic genus Methanosaeta. No Haloarchaea were detected, consistent with the need to add these organisms for COD and aromatic removal. Marinobacter and Halomonas dominated the eubacterial community. The presence of these genera is consistent with the ability to stimulate COD and aromatic removal with nutrient addition. In addition, anaerobic members of the phyla Thermotogae, Firmicutes, and unclassified eubacteria were identified and may represent reservoir organisms associated with the conversion hydrocarbons to methane.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ant foraging on foliage can substantially affect how phytophagous insects use host plants and represents a high predation risk for caterpillars, which are important folivores. Ant-plant-herbivore interactions are especially pervasive in cerrado savanna due to continuous ant visitation to liquid food sources on foliage (extrafloral nectaries, insect honeydew). While searching for liquid rewards on plants, aggressive ants frequently attack or kill insect herbivores, decreasing their numbers. Because ants vary in diet and aggressiveness, their effect on herbivores also varies. Additionally, the differential occurrence of ant attractants (plant and insect exudates) on foliage produces variable levels of ant foraging within local floras and among localities. Here, we investigate how variation of ant communities and of traits among host plant species (presence or absence of ant attractants) can change the effect of carnivores (predatory ants) on herbivore communities (caterpillars) in a cerrado savanna landscape. We sampled caterpillars and foliage-foraging ants in four cerrado localities (70-460 km apart). We found that: (i) caterpillar infestation was negatively related with ant visitation to plants; (ii) this relationship depended on local ant abundance and species composition, and on local preference by ants for plants with liquid attractants; (iii) this was not related to local plant richness or plant size; (iv) the relationship between the presence of ant attractants and caterpillar abundance varied among sites from negative to neutral; and (v) caterpillars feeding on plants with ant attractants are more resistant to ant predation than those feeding on plants lacking attractants. Liquid food on foliage mediates host plant quality for lepidopterans by promoting generalized ant-caterpillar antagonism. Our study in cerrado shows that the negative effects of generalist predatory ants on herbivores are detectable at a community level, affecting patterns of abundance and host plant use by lepidopterans. The magnitude of ant-induced effects on caterpillar occurrence across the cerrado landscape may depend on how ants use plants locally and how they respond to liquid food on plants at different habitats. This study enhances the relevance of plant-ant and ant-herbivore interactions in cerrado and highlights the importance of a tritrophic perspective in this ant-rich environment.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A fosmid metagenomic library was constructed with total community DNA obtained from a municipal wastewater treatment plant (MWWTP), with the aim of identifying new FeFe-hydrogenase genes encoding the enzymes most important for hydrogen metabolism. The dataset generated by pyrosequencing of a fosmid library was mined to identify environmental gene tags (EGTs) assigned to FeFe-hydrogenase. The majority of EGTs representing FeFe-hydrogenase genes were affiliated with the class Clostridia, suggesting that this group is the main hydrogen producer in the MWWTP analyzed. Based on assembled sequences, three FeFe-hydrogenase genes were predicted based on detection of the L2 motif (MPCxxKxxE) in the encoded gene product, confirming true FeFe-hydrogenase sequences. These sequences were used to design specific primers to detect fosmids encoding FeFe-hydrogenase genes predicted from the dataset. Three identified fosmids were completely sequenced. The cloned genomic fragments within these fosmids are closely related to members of the Spirochaetaceae, Bacteroidales and Firmicutes, and their FeFe-hydrogenase sequences are characterized by the structure type M3, which is common to clostridial enzymes. FeFe-hydrogenase sequences found in this study represent hitherto undetected sequences, indicating the high genetic diversity regarding these enzymes in MWWTP. Results suggest that MWWTP have to be considered as reservoirs for new FeFe-hydrogenase genes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objectives were to identify factors associated with decreased life satisfaction in community-dwelling elderly and describe such factors according to gender and age bracket. The study interviewed 2,472 elderly individuals 65 years or older without cognitive deficits suggestive of dementia, in probabilistic samples from seven Brazilian cities. All measures were self-reported except for functional performance, indicated by handgrip and gait speed. Women had more chronic diseases, worse functional performance, and greater social involvement when compared to men. The oldest participants showed worse functional performance and less social involvement when compared to the youngest. Low satisfaction was associated with three or more diseases, memory problems, low social involvement, low handgrip strength, and urinary incontinence. The authors conclude that health, functional performance, and social involvement interact with well-being, so interventions targeting these areas can favor quality of life for the elderly.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We analyzed the structure of the understory community in the Atlantic Forest sensu lato, for which phytosociological descriptions of the understory are lacking. We delineated 50 plots of 10 × 20 m each at four sites within an Araucaria forest (a subtype of Atlantic Forest), located in the municipalities of Bananal, Campos do Jordão, Itaberá and Barra do Chapéu, all of which are in the state of São Paulo, Brazil. To sample the resident species of the understory, we randomly selected five 1 × 1 m subplots within each plot, resulting in a total sampling area of 250 m² at each site. We identified differences among the locations, mostly due to proportional differences in growth forms, in terms of species richness and the importance values within the community. Factors potentially influencing the understory structure include macroclimatic and microclimatic conditions, as well as forest fragmentation, the abundance of deciduous trees in the canopy, the surrounding vegetation and geographic location.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.