11 resultados para detection efficiency

em Reposit


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Intermittent fasting (IF) is an often-used intervention to decrease body mass. In male Sprague-Dawley rats, 24 hour cycles of IF result in light caloric restriction, reduced body mass gain, and significant decreases in the efficiency of energy conversion. Here, we study the metabolic effects of IF in order to uncover mechanisms involved in this lower energy conversion efficiency. After 3 weeks, IF animals displayed overeating during fed periods and lower body mass, accompanied by alterations in energy-related tissue mass. The lower efficiency of energy use was not due to uncoupling of muscle mitochondria. Enhanced lipid oxidation was observed during fasting days, whereas fed days were accompanied by higher metabolic rates. Furthermore, an increased expression of orexigenic neurotransmitters AGRP and NPY in the hypothalamus of IF animals was found, even on feeding days, which could explain the overeating pattern. Together, these effects provide a mechanistic explanation for the lower efficiency of energy conversion observed. Overall, we find that IF promotes changes in hypothalamic function that explain differences in body mass and caloric intake.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study compares the impact of obesogenic environment (OE) in six different periods of development on sperm parameters and the testicular structure of adult rats and their correlations with sex steroid and metabolic scenario. Wistar rats were exposed to OE during gestation (O1), during gestation/lactation (O2), from weaning to adulthood (O3), from lactation to adulthood (O4), from gestation to sexual maturity (O5), and after sexual maturation (O6). OE was induced by a 20% fat diet, and control groups were fed a balanced diet (4% fat). Serum leptin levels and adiposity index indicate that all groups were obese, except for O1. Three progressive levels of impaired metabolic status were observed: O1 presented insulin resistance, O2 were insulin resistant and obese, and groups O3, O4, and O5 were insulin resistant, obese, and diabetic. These three levels of metabolic damage were proportional to the increase of leptin and decreased circulating testosterone. The impairment in the daily sperm production (DSP) paralleled these three levels of metabolic and hormonal damage being marginal in O1, increasing in O2, and being higher in groups O3, O4, O5, and O6. None of the OE periods affected the sperm transit time in the epididymis, and the lower sperm reserves were caused mainly by impaired DSP. In conclusion, OE during sexual maturation markedly reduces the DSP at adulthood in the rat. A severe reduction in the DSP also occurs in OE exposure during gestation/lactation but not in gestation, indicating that breast-feeding is a critical period for spermatogenic impairment under obesogenic conditions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tomato (Solanum lycopersicum) shows three growth habits: determinate, indeterminate and semi-determinate. These are controlled mainly by allelic variation in the SELF-PRUNING (SP) gene family, which also includes the florigen gene SINGLE FLOWER TRUSS (SFT). Determinate cultivars have synchronized flower and fruit production, which allows mechanical harvesting in the tomato processing industry, whereas indeterminate ones have more vegetative growth with continuous flower and fruit formation, being thus preferred for fresh market tomato production. The semi-determinate growth habit is poorly understood, although there are indications that it combines advantages of determinate and indeterminate growth. Here, we used near-isogenic lines (NILs) in the cultivar Micro-Tom (MT) with different growth habit to characterize semi-determinate growth and to determine its impact on developmental and productivity traits. We show that semi-determinate genotypes are equivalent to determinate ones with extended vegetative growth, which in turn impacts shoot height, number of leaves and either stem diameter or internode length. Semi-determinate plants also tend to increase the highly relevant agronomic parameter Brix×ripe yield (BRY). Water-use efficiency (WUE), evaluated either directly as dry mass produced per amount of water transpired or indirectly through C isotope discrimination, was higher in semi-determinate genotypes. We also provide evidence that the increases in BRY in semi-determinate genotypes are a consequence of an improved balance between vegetative and reproductive growth, a mechanism analogous to the conversion of the overly vegetative tall cereal varieties into well-balanced semi-dwarf ones used in the Green Revolution.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

G-quadruplexes are secondary structures present in DNA and RNA molecules, which are formed by stacking of G-quartets (i.e., interaction of four guanines (G-tracts) bounded by Hoogsteen hydrogen bonding). Human PAX9 intron 1 has a putative G-quadruplex-forming region located near exon 1, which is present in all known sequenced placental mammals. Using circular dichroism (CD) analysis and CD melting, we showed that these sequences are able to form highly stable quadruplex structures. Due to the proximity of the quadruplex structure to exon-intron boundary, we used a validated double-reporter splicing assay and qPCR to analyze its role on splicing efficiency. The human quadruplex was shown to have a key role on splicing efficiency of PAX9 intron 1, as a mutation that abolished quadruplex formation decreased dramatically the splicing efficiency of human PAX9 intron 1. The less stable, rat quadruplex had a less efficient splicing when compared to human sequences. Additionally, the treatment with 360A, a strong ligand that stabilizes quadruplex structures, further increased splicing efficiency of human PAX9 intron 1. Altogether, these results provide evidences that G-quadruplex structures are involved in splicing efficiency of PAX9 intron 1.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Plants that deploy a phosphorus (P)-mobilising strategy based on the release of carboxylates tend to have high leaf manganese concentrations ([Mn]). This occurs because the carboxylates mobilise not only soil inorganic and organic P, but also a range of micronutrients, including Mn. Concentrations of most other micronutrients increase to a small extent, but Mn accumulates to significant levels, even when plants grow in soil with low concentrations of exchangeable Mn availability. Here, we propose that leaf [Mn] can be used to select for genotypes that are more efficient at acquiring P when soil P availability is low. Likewise, leaf [Mn] can be used to screen for belowground functional traits related to nutrient-acquisition strategies among species in low-P habitats.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.