4 resultados para based inspection and conditional monitoring
em Reposit
Resumo:
The vast majority of maternal deaths in low-and middle-income countries are preventable. Delay in obtaining access to appropriate health care is a fairly common problem which can be improved. The objective of this study was to explore the association between delay in providing obstetric health care and severe maternal morbidity/death. This was a multicentre cross-sectional study, involving 27 referral obstetric facilities in all Brazilian regions between 2009 and 2010. All women admitted to the hospital with a pregnancy-related cause were screened, searching for potentially life-threatening conditions (PLTC), maternal death (MD) and maternal near-miss (MNM) cases, according to the WHO criteria. Data on delays were collected by medical chart review and interview with the medical staff. The prevalence of the three different types of delays was estimated according to the level of care and outcome of the complication. For factors associated with any delay, the PR and 95%CI controlled for cluster design were estimated. A total of 82,144 live births were screened, with 9,555 PLTC, MNM or MD cases prospectively identified. Overall, any type of delay was observed in 53.8% of cases; delay related to user factors was observed in 10.2%, 34.6% of delays were related to health service accessibility and 25.7% were related to quality of medical care. The occurrence of any delay was associated with increasing severity of maternal outcome: 52% in PLTC, 68.4% in MNM and 84.1% in MD. Although this was not a population-based study and the results could not be generalized, there was a very clear and significant association between frequency of delay and severity of outcome, suggesting that timely and proper management are related to survival.
Resumo:
The aim of the present study was to perform an in vitro analysis of the antimicrobial and antiproliferative potential of an extract from Anadenanthera colubrina (Vell.) Brenan (angico) and chemically characterize the crude extract. Antimicrobial action was evaluated based on the minimum inhibitory concentration (MIC), minimum bactericidal/fungicidal concentration, and the inhibition of formation to oral biofilm. Cell morphology was determined through scanning electron microscopy (SEM). Six strains of tumor cells were used for the determination of antiproliferative potential. The extract demonstrated strong antifungal activity against Candida albicans ATCC 18804 (MIC = 0.031 mg/mL), with similar activity found regarding the ethyl acetate fraction. The extract and active fraction also demonstrated the capacity to inhibit the formation of Candida albicans to oral biofilm after 48 hours, with median values equal to or greater than the control group, but the difference did not achieve statistical significance (P > 0.05). SEM revealed alterations in the cell morphology of the yeast. Regarding antiproliferative activity, the extract demonstrated cytostatic potential in all strains tested. The present findings suggest strong antifungal potential for Anadenanthera colubrina (Vell.) Brenan as well as a tendency toward diminishing the growth of human tumor cells.
Resumo:
Peripheral insulin resistance (IR) is one of the main side effects caused by glucocorticoid (GC)-based therapies, and the molecular mechanisms of GC-induced IR are not yet fully elucidated. Thus, we aimed to investigate the effects of dexamethasone treatment on the main components of insulin and inflammatory signaling in the adipose tissue of rats. Male Wistar rats received daily injections of dexamethasone (1mg/kg body weight (b.w.), intraperitoneally (i.p.)) for 5 days (DEX), whereas control rats received saline (CTL). The metabolic status was investigated, and the epididymal fat fragments were collected for lipolysis and western blot analyses. The DEX rats became hyperglycemic, hyperinsulinemic, insulin resistant and glucose intolerant, compared with the CTL rats (P<0.05). The basal glycerol release in the fat fragments was 1.5-fold higher in the DEX rats (P<0.05). The phosphorylation of protein kinase B (PKB) at ser(473) decreased by 44%, whereas, the phosphorylation of insulin receptor substrate (IRS)-1 at ser(307) increased by 93% in the adipose tissue of the DEX rats after an oral bolus of glucose (P<0.05). The basal phosphorylation of c-jun-N-terminal kinase (JNK) and inhibitor of nuclear factor kappa-B (IKKβ) proteins was reduced by 46% and 58%, respectively, in the adipose tissue of the DEX rats (P<0.05). This was paralleled with a significant reduction (47%) in the glucocorticoid receptor (GR) protein content in the adipose tissue of the DEX rats (P<0.05). The insulin-resistant status of rats induced by dexamethasone administration have PKB and IRS-1 activity attenuated in epididymal fat without increases in the phosphorylation of the proinflammatory signals JNK and IKKβ.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.