17 resultados para automatic target detection

em Reposit


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Differential gene expression analysis by suppression subtractive hybridization with correlation to the metabolic pathways involved in chronic myeloid leukemia (CML) may provide a new insight into the pathogenesis of CML. Among the overexpressed genes found in CML at diagnosis are SEPT5, RUNX1, MIER1, KPNA6 and FLT3, while PAN3, TOB1 and ITCH were decreased when compared to healthy volunteers. Some genes were identified and involved in CML for the first time, including TOB1, which showed a low expression in patients with CML during tyrosine kinase inhibitor treatment with no complete cytogenetic response. In agreement, reduced expression of TOB1 was also observed in resistant patients with CML compared to responsive patients. This might be related to the deregulation of apoptosis and the signaling pathway leading to resistance. Most of the identified genes were related to the regulation of nuclear factor κB (NF-κB), AKT, interferon and interleukin-4 (IL-4) in healthy cells. The results of this study combined with literature data show specific gene pathways that might be explored as markers to assess the evolution and prognosis of CML as well as identify new therapeutic targets.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

15

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This clinical study has investigated the antigenic activity of bacterial contents from exudates of acute apical abscesses (AAAs) and their paired root canal contents regarding the stimulation capacity by levels of interleukin (IL)-1 beta and tumor necrosis factor alpha (TNF-α) throughout the root canal treatment against macrophage cells. Paired samples of infected root canals and exudates of AAAs were collected from 10 subjects. Endodontic contents were sampled before (root canal sample [RCS] 1) and after chemomechanical preparation (RCS2) and after 30 days of intracanal medication with calcium hydroxide + chlorhexidine gel (Ca[OH]2 + CHX gel) (RCS3). Polymerase chain reaction (16S rDNA) was used for detection of the target bacteria, whereas limulus amebocyte lysate was used to measure endotoxin levels. Raw 264.7 macrophages were stimulated with AAA exudates from endodontic contents sampled in different moments of root canal treatment. Enzyme-linked immunosorbent assays were used to measure the levels of TNF-α and IL-1 beta. Parvimonas micra, Porphyromonas endodontalis, Dialister pneumosintes, and Prevotella nigrescens were the most frequently detected species. Higher levels of endotoxins were found in samples from periapical exudates at RCS1 (P < .005). In fact, samples collected from periapical exudates showed a higher stimulation capacity at RCS1 (P < .05). A positive correlation was found between endotoxins from exudates with IL-1 beta (r = 0.97) and TNF-α (r = 0.88) production (P < .01). The significant reduction of endotoxins and bacterial species achieved by chemomechanical procedures (RCS2) resulted in a lower capacity of root canal contents to stimulate the cells compared with that at RCS1 (P < .05). The use of Ca(OH)2 + CHX gel as an intracanal medication (RCS3) improved the removal of endotoxins and bacteria from infected root canals (P < .05) whose contents induced a lower stimulation capacity against macrophages cells at RCS1, RCS2, and RCS3 (P < .05). AAA exudates showed higher levels of endotoxins and showed a greater capacity of macrophage stimulation than the paired root canal samples. Moreover, the use of intracanal medication improved the removal of bacteria and endotoxins from infected root canals, which may have resulted in the reduction of the inflammatory potential of the root canal content.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Resistant hypertension (RHTN) includes patients with controlled blood pressure (BP) (CRHTN) and uncontrolled BP (UCRHTN). In fact, RHTN patients are more likely to have target organ damage (TOD), and resistin, leptin and adiponectin may affect BP control in these subjects. We assessed the relationship between adipokines levels and arterial stiffness, left ventricular hypertrophy (LVH) and microalbuminuria (MA). This cross-sectional study included CRHTN (n=51) and UCRHTN (n=38) patients for evaluating body mass index, ambulatory blood pressure monitoring, plasma adiponectin, leptin and resistin concentrations, pulse wave velocity (PWV), MA and echocardiography. Leptin and resistin levels were higher in UCRHTN, whereas adiponectin levels were lower in this same subgroup. Similarly, arterial stiffness, LVH and MA were higher in UCRHTN subgroup. Adiponectin levels negatively correlated with PWV (r=-0.42, P<0.01), and MA (r=-0.48, P<0.01) only in UCRHTN. Leptin was positively correlated with PWV (r=0.37, P=0.02) in UCRHTN subgroup, whereas resistin was not correlated with TOD in both subgroups. Adiponectin is associated with arterial stiffness and renal injury in UCRHTN patients, whereas leptin is associated with arterial stiffness in the same subgroup. Taken together, our results showed that those adipokines may contribute to vascular and renal damage in UCRHTN patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study investigated the presence of the Treponema species in longstanding endodontic retreatment-resistant lesions of teeth with apical periodontitis, the association of this species with clinical/radiographic features, and the association among the different target species. Microbial samples of apical lesions were collected from twenty-five adult patients referred to endodontic surgery after unsuccessful root canal retreatment. Nested-PCR and conventional PCR were used for Treponema detection. Twenty-three periradicular tissue samples showed detectable levels of bacterial DNA. Treponema species were detected in 28% (7/25) of the cases. The most frequently detected species were T. socranskii (6/25), followed by T. maltophilum (3/25), T. amylovorum (3/25), T. lecithinolyticum (3/25), T. denticola (3/25), T. pectinovorum (2/25) and T. medium (2/25). T. vicentii was not detected in any sample. Positive statistical association was found between T. socranskii and T. denticola, and between T. maltophilum and T. lecithinolyticum . No association was detected between the presence of any target microorganism and the clinical or radiographic features. Treponema spp. are present, in a low percentage, in longstanding apical lesions from teeth with endodontic retreatment failure.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Structural Genomics Consortium (SGC) and its clinical, industry and disease-foundation partners are launching open-source preclinical translational medicine studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

studies have shown that rate of propofol infusion may influence the predicted propofol concentration at the effect site (Es). The aim of this study was to evaluate the Es predicted by the Marsh pharmacokinetic model (ke0 0.26min(-1)) in loss of consciousness during fast or slow induction. the study included 28 patients randomly divided into two equal groups. In slow induction group (S), target-controlled infusion (TCI) of propofol with plasma, Marsh pharmacokinetic model (ke0 0.26min(-1)) with target concentration (Tc) at 2.0-μg.mL(-1) were administered. When the predicted propofol concentration at the effect site (Es) reached half of Es value, Es was increased to previous Es + 1μg.mL(-1), successively, until loss of consciousness. In rapid induction group (R), patients were induced with TCI of propofol with plasma (6.0μg.ml(-1)) at Es, and waited until loss of consciousness. in rapid induction group, Tc for loss of consciousness was significantly lower compared to slow induction group (1.67±0.76 and 2.50±0.56μg.mL(-1), respectively, p=0.004). the predicted propofol concentration at the effect site for loss of consciousness is different for rapid induction and slow induction, even with the same pharmacokinetic model of propofol and the same balance constant between plasma and effect site.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study investigated the presence of target bacterial species and the levels of endotoxins in teeth with apical periodontitis. Levels of inflammatory mediators (interleukin [IL]-1β and tumor necrosis factor [TNF]-α) were determined after macrophage stimulation with endodontic content after different phases of endodontic therapy using different irrigants. Thirty primarily infected root canals were randomly assigned into 3 groups according to the irrigant used for root canal preparation (n = 10 per group): GI: 2.5% sodium hypochlorite, GII: 2% chlorhexidine gel, and GIII (control group): saline solution. Root canal samples were taken by using paper points before (s1) and after root canal instrumentation (s2), subsequently to 17% EDTA (s3), after 30 days of intracanal medication (Ca[OH]2 + saline solution) (s4), and before root canal obturation (s5). Polymerase chain reaction (16S recombinant DNA) and limulus amebocyte lysate assay were used for bacterial and endotoxin detection, respectively. Macrophages were stimulated with the root canal contents for IL-1β/TNF-α measurement using enzyme-linked immunosorbent assay. Porphyromonas gingivalis (17/30), Porphyromonas endodontalis (15/30), and Prevotella nigrescens (11/30) were the most prevalent bacterial species. At s1, endotoxins were detected in 100% of the root canals (median = 32.43 EU/mL). In parallel, substantial amounts of IL-1β and TNF-α were produced by endodontic content-stimulated macrophages. At s2, a significant reduction in endotoxin levels was observed in all groups, with GI presenting the greatest reduction (P < .05). After a root canal rinse with EDTA (s3), intracanal medication (s4), and before root canal obturation (s5), endotoxin levels reduced without differences between groups (P < .05). IL-1β and TNF-α release decreased proportionally to the levels of residual endotoxin (P < .05). Regardless of the use of sodium hypochlorite or CHX, the greatest endotoxin reduction occurs after chemomechanical preparation. Increasing steps of root canal therapy associated with intracanal medication enhances endotoxin reduction, leading to a progressively lower activation of proinflammatory cells such as macrophages.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Chronic ethanol consumption leads to reproductive damages, since it can act directly in the tissues or indirectly, causing a hormonal imbalance. Prostate is a hormone-dependent gland and, consequently, susceptible to ethanol. The potential of testosterone therapy in the ethanol-related disorders was investigated in the prostate microenvironment. UChB rats aged 90 days were divided into 2 experimental groups (n=20): C: drinking water only and EtOH: drinking 10% (v/v) ethanol at >2 g/kg body weight/day+water. At 150 days old, 10 rats from each group received subcutaneous injections of testosterone cypionate (5 mg/kg body weight) diluted in corn oil every other day for 4 weeks, constituting T and EtOH+T, while the remaining animals received corn oil as vehicle. Animals were euthanized at 180 days old, by decapitation. Blood was collected to obtain hormone concentrations and ventral prostate was dissected and processed for light microscope and molecular analyses. Ventral prostate weight, plasma testosterone and DHT and intraprostatic testosterone concentrations were increased after testosterone treatment. Plasma estradiol level was reduced in the EtOH+T. Inflammatory foci, metaplasia and epithelial atrophy were constantly found in the prostate of EtOH and were not observed after hormonal therapy. No differences were found in the expression of AR, ERβ and DACH-1. Additionally, testosterone treatment down-regulated ERα and increased the e-cadherin and α-actinin immunoreactivities. Testosterone was able to reverse damages caused by ethanol consumption in the prostate microenvironment and becomes a possible target to be investigated to ethanol-related disorders.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.