12 resultados para Truncated robust multivariate outlier detection
em Reposit
Resumo:
In acquired immunodeficiency syndrome (AIDS) studies it is quite common to observe viral load measurements collected irregularly over time. Moreover, these measurements can be subjected to some upper and/or lower detection limits depending on the quantification assays. A complication arises when these continuous repeated measures have a heavy-tailed behavior. For such data structures, we propose a robust structure for a censored linear model based on the multivariate Student's t-distribution. To compensate for the autocorrelation existing among irregularly observed measures, a damped exponential correlation structure is employed. An efficient expectation maximization type algorithm is developed for computing the maximum likelihood estimates, obtaining as a by-product the standard errors of the fixed effects and the log-likelihood function. The proposed algorithm uses closed-form expressions at the E-step that rely on formulas for the mean and variance of a truncated multivariate Student's t-distribution. The methodology is illustrated through an application to an Human Immunodeficiency Virus-AIDS (HIV-AIDS) study and several simulation studies.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
Conventional reflectance spectroscopy (NIRS) and hyperspectral imaging (HI) in the near-infrared region (1000-2500 nm) are evaluated and compared, using, as the case study, the determination of relevant properties related to the quality of natural rubber. Mooney viscosity (MV) and plasticity indices (PI) (PI0 - original plasticity, PI30 - plasticity after accelerated aging, and PRI - the plasticity retention index after accelerated aging) of rubber were determined using multivariate regression models. Two hundred and eighty six samples of rubber were measured using conventional and hyperspectral near-infrared imaging reflectance instruments in the range of 1000-2500 nm. The sample set was split into regression (n = 191) and external validation (n = 95) sub-sets. Three instruments were employed for data acquisition: a line scanning hyperspectral camera and two conventional FT-NIR spectrometers. Sample heterogeneity was evaluated using hyperspectral images obtained with a resolution of 150 × 150 μm and principal component analysis. The probed sample area (5 cm(2); 24,000 pixels) to achieve representativeness was found to be equivalent to the average of 6 spectra for a 1 cm diameter probing circular window of one FT-NIR instrument. The other spectrophotometer can probe the whole sample in only one measurement. The results show that the rubber properties can be determined with very similar accuracy and precision by Partial Least Square (PLS) regression models regardless of whether HI-NIR or conventional FT-NIR produce the spectral datasets. The best Root Mean Square Errors of Prediction (RMSEPs) of external validation for MV, PI0, PI30, and PRI were 4.3, 1.8, 3.4, and 5.3%, respectively. Though the quantitative results provided by the three instruments can be considered equivalent, the hyperspectral imaging instrument presents a number of advantages, being about 6 times faster than conventional bulk spectrometers, producing robust spectral data by ensuring sample representativeness, and minimizing the effect of the presence of contaminants.
Resumo:
Diabetic Retinopathy (DR) is a complication of diabetes that can lead to blindness if not readily discovered. Automated screening algorithms have the potential to improve identification of patients who need further medical attention. However, the identification of lesions must be accurate to be useful for clinical application. The bag-of-visual-words (BoVW) algorithm employs a maximum-margin classifier in a flexible framework that is able to detect the most common DR-related lesions such as microaneurysms, cotton-wool spots and hard exudates. BoVW allows to bypass the need for pre- and post-processing of the retinographic images, as well as the need of specific ad hoc techniques for identification of each type of lesion. An extensive evaluation of the BoVW model, using three large retinograph datasets (DR1, DR2 and Messidor) with different resolution and collected by different healthcare personnel, was performed. The results demonstrate that the BoVW classification approach can identify different lesions within an image without having to utilize different algorithms for each lesion reducing processing time and providing a more flexible diagnostic system. Our BoVW scheme is based on sparse low-level feature detection with a Speeded-Up Robust Features (SURF) local descriptor, and mid-level features based on semi-soft coding with max pooling. The best BoVW representation for retinal image classification was an area under the receiver operating characteristic curve (AUC-ROC) of 97.8% (exudates) and 93.5% (red lesions), applying a cross-dataset validation protocol. To assess the accuracy for detecting cases that require referral within one year, the sparse extraction technique associated with semi-soft coding and max pooling obtained an AUC of 94.2 ± 2.0%, outperforming current methods. Those results indicate that, for retinal image classification tasks in clinical practice, BoVW is equal and, in some instances, surpasses results obtained using dense detection (widely believed to be the best choice in many vision problems) for the low-level descriptors.
Resumo:
Super elastic nitinol (NiTi) wires were exploited as highly robust supports for three distinct crosslinked polymeric ionic liquid (PIL)-based coatings in solid-phase microextraction (SPME). The oxidation of NiTi wires in a boiling (30%w/w) H2O2 solution and subsequent derivatization in vinyltrimethoxysilane (VTMS) allowed for vinyl moieties to be appended to the surface of the support. UV-initiated on-fiber copolymerization of the vinyl-substituted NiTi support with monocationic ionic liquid (IL) monomers and dicationic IL crosslinkers produced a crosslinked PIL-based network that was covalently attached to the NiTi wire. This alteration alleviated receding of the coating from the support, which was observed for an analogous crosslinked PIL applied on unmodified NiTi wires. A series of demanding extraction conditions, including extreme pH, pre-exposure to pure organic solvents, and high temperatures, were applied to investigate the versatility and robustness of the fibers. Acceptable precision of the model analytes was obtained for all fibers under these conditions. Method validation by examining the relative recovery of a homologous group of phthalate esters (PAEs) was performed in drip-brewed coffee (maintained at 60 °C) by direct immersion SPME. Acceptable recoveries were obtained for most PAEs in the part-per-billion level, even in this exceedingly harsh and complex matrix.
Resumo:
Flavanones (hesperidin, naringenin, naringin, and poncirin) in industrial, hand-squeezed orange juices and from fresh-in-squeeze machines orange juices were determined by HPLC/DAD analysis using a previously described liquid-liquid extraction method. Method validation including the accuracy was performed by using recovery tests. Samples (36) collected from different Brazilian locations and brands were analyzed. Concentrations were determined using an external standard curve. The limits of detection (LOD) and the limits of quantification (LOQ) calculated were 0.0037, 1.87, 0.0147, and 0.0066 mg 100 g(-1) and 0.0089, 7.84, 0.0302, and 0.0200 mg 100 g(-1) for naringin, hesperidin, poncirin, and naringenin, respectively. The results demonstrated that hesperidin was present at the highest concentration levels, especially in the industrial orange juices. Its average content and concentration range were 69.85 and 18.80-139.00 mg 100 g(-1). The other flavanones showed the lowest concentration levels. The average contents and concentration ranges found were 0.019, 0.01-0.30, and 0.12 and 0.1-0.17, 0.13, and 0.01-0.36 mg 100 g(-1), respectively. The results were also evaluated using the principal component analysis (PCA) multivariate analysis technique which showed that poncirin, naringenin, and naringin were the principal elements that contributed to the variability in the sample concentrations.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
To identify the prevalence and the severity of malocclusions and to analyze factors associated with the need for orthodontic treatment of Brazilian adolescents. This exploratory, cross-sectional study was carried out based on secondary data from the national epidemiological survey on oral health in Brazil (2002-2003). Socio-demographic conditions, self-perception, and the existence and degree of malocclusion, using the Dental Aesthetic Index, were evaluated in 16,833 adolescent Brazilians selected by probabilistic sample by conglomerates. The dependent variable - need orthodontic treatment - was estimated from the severity of malocclusion. The magnitude and direction of the association in bivariate and multivariate analyzes from a Robust Poisson regression was estimated RESULTS: The majority of the adolescents needed orthodontic treatment (53.2%). In the multivariate analysis, the prevalence of the need for orthodontic treatment was larger among females, non-whites, those that perceived a need for treatment, and those that perceived their appearance as normal, bad, or very bad. The need for orthodontic treatment was smaller among those that lived in the Northeast and Central West macro-regions compared to those living in Southeast Brazil and it was also smaller among those that perceived their chewing to be normal or their oral health to be bad or very bad. There was a high prevalence of orthodontic treatment need among adolescents in Brazil and this need was associated with demographic and subjective issues. The high prevalence of orthodontic needs in adolescents is a challenge to the goals of Brazil's universal public health system.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.