22 resultados para Specific closed sequential patterns
em Reposit
Resumo:
Hippocampal sclerosis (HS) is considered the most frequent neuropathological finding in patients with mesial temporal lobe epilepsy (MTLE). Hippocampal specimens of pharmacoresistant MTLE patients that underwent epilepsy surgery for seizure control reveal the characteristic pattern of segmental neuronal cell loss and concomitant astrogliosis. However, classification issues of hippocampal lesion patterns have been a matter of intense debate. International consensus classification has only recently provided significant progress for comparisons of neurosurgical and clinic-pathological series between different centers. The respective four-tiered classification system of the International League Against Epilepsy subdivides HS into three types and includes a term of gliosis only, no-HS. Future studies will be necessary to investigate whether each of these subtypes of HS may be related to different etiological factors or with postoperative memory and seizure outcome. Molecular studies have provided potential deeper insights into the pathogenesis of HS and MTLE on the basis of epilepsy-surgical hippocampal specimens and corresponding animal models. These include channelopathies, activation of NMDA receptors, and other conditions related to Ca(2+) influx into neurons, the imbalance of Ca(2+)-binding proteins, acquired channelopathies that increase neuronal excitability, paraneoplastic and non-paraneoplastic inflammatory events, and epigenetic regulation promoting or facilitating hippocampal epileptogenesis. Genetic predisposition for HS is clearly suggested by the high incidence of family history in patients with HS, and by familial MTLE with HS. So far, it is clear that HS is multifactorial and there is no individual pathogenic factor either necessary or sufficient to generate this intriguing histopathological condition. The obvious variety of pathogenetic combinations underlying HS may explain the multitude of clinical presentations, different responses to clinical and surgical treatment. We believe that the stratification of neuropathological patterns can help to characterize specific clinic-pathological entities and predict the postsurgical seizure control in an improved fashion.
Resumo:
The reproductive capacity between Triatoma lenti and Triatoma sherlocki was observed in order to verify the fertility and viability of the offspring. Cytogenetic, morphological and morphometric approaches were used to analyze the differences that were inherited. Experimental crosses were performed in both directions. The fertility rate of the eggs in crosses involving T. sherlocki females was 65% and 90% in F1 and F2 offspring, respectively. In reciprocal crosses, it was 7% and 25% in F1 and F2 offspring, respectively. The cytogenetic analyses of the male meiotic process of the hybrids were performed using lacto-acetic orcein, C-banding and Feulgen techniques. The male F1 offspring presented normal chromosome behavior, a finding that was similar to those reported in parental species. However, cytogenetic analysis of F2 offspring showed errors in chromosome pairing. This post-zygotic isolation, which prevents hybrids in nature, may represent the collapse of the hybrid. This phenomenon is due to a genetic dysregulation that occurs in the chromosomes of F1. The results were similar in the hybrids from both crosses. Morphological features, such as color and size of connexive and the presence of red-orange rings on the femora, were similar to T. sherlocki, while wins size was similar to T. lenti in F1 offspring. The eggshells showed characteristics that were similar to species of origin, whereas the median process of the pygophore resulted in intermediate characteristics in the F1 and a segregating pattern in F2 offspring. Geometric morphometric techniques used on the wings showed that both F1 and F2 offspring were similar to T. lenti. These studies on the reproductive capacity between T. lenti and T. sherlocki confirm that both species are evolutionarily closed; hence, they are included in the brasiliensis subcomplex. The extremely reduced fertility observed in the F2 hybrids confirmed the specific status of the species that were analyzed.
Resumo:
The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.
Resumo:
Sugarcane is a monocot plant that accumulates sucrose to levels of up to 50% of dry weight in the stalk. The mechanisms that are involved in sucrose accumulation in sugarcane are not well understood, and little is known with regard to factors that control the extent of sucrose storage in the stalks. UDP-glucose pyrophosphorylase (UGPase; EC 2.7.7.9) is an enzyme that produces UDP-glucose, a key precursor for sucrose metabolism and cell wall biosynthesis. The objective of this work was to gain insights into the ScUGPase-1 expression pattern and regulatory mechanisms that control protein activity. ScUGPase-1 expression was negatively correlated with the sucrose content in the internodes during development, and only slight differences in the expression patterns were observed between two cultivars that differ in sucrose content. The intracellular localization of ScUGPase-1 indicated partial membrane association of this soluble protein in both the leaves and internodes. Using a phospho-specific antibody, we observed that ScUGPase-1 was phosphorylated in vivo at the Ser-419 site in the soluble and membrane fractions from the leaves but not from the internodes. The purified recombinant enzyme was kinetically characterized in the direction of UDP-glucose formation, and the enzyme activity was affected by redox modification. Preincubation with H2O2 strongly inhibited this activity, which could be reversed by DTT. Small angle x-ray scattering analysis indicated that the dimer interface is located at the C terminus and provided the first structural model of the dimer of sugarcane UGPase in solution.
Resumo:
Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.
Resumo:
Jute fiber is the second most common natural cellulose fiber worldwide, especially in recent years, due to its excellent physical, chemical and structural properties. The objective of this paper was to investigate: the thermal degradation of in natura jute fiber, and the production and characterization of the generated activated carbon. The production consisted of carbonization of the jute fiber and activation with steam. During the activation step the amorphous carbon produced in the initial carbonization step reacted with oxidizing gas, forming new pores and opening closed pores, which enhanced the adsorptive capacity of the activated carbon. N2 gas adsorption at 77K was used in order to evaluate the effect of the carbonization and activation steps. The results of the adsorption indicate the possibility of producing a porous material with a combination of microporous and mesoporous structure, depending on the parameters used in the processes, with resulting specific surface area around 470 m2.g-1. The thermal analysis indicates that above 600°C there is no significant mass loss.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
With a huge amount of printed documents nowadays, identifying their source is useful for criminal investigations and also to authenticate digital copies of a document. In this paper, we propose novel techniques for laser printer attribution. Our solutions do not need very high resolution scanning of the investigated document and explore the multidirectional, multiscale and low-level gradient texture patterns yielded by printing devices. The main contributions of this work are: (1) the description of printed areas using multidirectional and multiscale co-occurring texture patterns; (2) description of texture on low-level gradient areas by a convolution texture gradient filter that emphasizes textures in specific transition areas and (3) the analysis of printer patterns in segments of interest, which we call frames, instead of whole documents or only printed letters. We show by experiments in a well documented dataset that the proposed methods outperform techniques described in the literature and present near-perfect classification accuracy being very promising for deployment in real-world forensic investigations.
Resumo:
To characterize cumulative joint damage (CJD) patterns in rheumatoid arthritis (RA) and determine their associations with demographic/clinical features and HLA-DRB1 gene polymorphism. Hand and foot radiographs were obtained from 404 patients with RA. CJD patterns were determined by 3 derivations from Sharp/van der Heijde scores, obtained by the mathematical division of scores for hands/feet (Sharp-h/f score), fingers/wrists (Sharp-f/w score), and erosion/space narrowing (Sharp-e/sn score), respectively. DNA and serum were obtained for determination of HLA-DRB1 polymorphism, rheumatoid factor (RF), and anticitrullinated protein antibodies (ACPA). Patients with wrist-dominant CJD pattern were more likely to have severe RA than those with finger-dominant pattern (68.4% vs 46.0%; p = 0.036) as were those with foot-dominant vs hand-dominant CJD pattern (76.5% vs 56.4%; p = 0.044). HLA-DRB1 shared epitope (SE) alleles were associated with erosion-dominant CJD pattern (p = 0.021). Patients with erosion-dominant CJD pattern had higher levels of RF and ACPA than those with space-narrowing-dominant CJD pattern (median RF 71.35 U/ml vs 22.05 U/ml, respectively; p = 0.003; median ACPA 187.9 U/ml vs 143.2 U/ml, respectively; p < 0.001). The majority of triple-positive patients (SE+, RF+, ACPA+) had erosion-dominant CJD pattern (62.3%) while the majority of triple-negative patients (SE-, FR-, ACPA-) had space narrowing-dominant CJD pattern (75%; p = 0.017). ACPA was associated with HLA-DRB1 SE alleles (p < 0.05). Patients with foot-dominant CJD pattern were taller than those with hand-dominant CJD pattern (p = 0.002); those with erosion-dominant CJD pattern had higher weight and body mass index than those with space narrowing-dominant CJD pattern (p = 0.014, p = 0.001). CJD patterns were associated with disease severity, HLA-DRB1 SE status, presence and titer of ACPA and RF, and morphometric features.
Resumo:
Trees from tropical montane cloud forest (TMCF) display very dynamic patterns of water use. They are capable of downwards water transport towards the soil during leaf-wetting events, likely a consequence of foliar water uptake (FWU), as well as high rates of night-time transpiration (Enight) during drier nights. These two processes might represent important sources of water losses and gains to the plant, but little is known about the environmental factors controlling these water fluxes. We evaluated how contrasting atmospheric and soil water conditions control diurnal, nocturnal and seasonal dynamics of sap flow in Drimys brasiliensis (Miers), a common Neotropical cloud forest species. We monitored the seasonal variation of soil water content, micrometeorological conditions and sap flow of D. brasiliensis trees in the field during wet and dry seasons. We also conducted a greenhouse experiment exposing D. brasiliensis saplings under contrasting soil water conditions to deuterium-labelled fog water. We found that during the night D. brasiliensis possesses heightened stomatal sensitivity to soil drought and vapour pressure deficit, which reduces night-time water loss. Leaf-wetting events had a strong suppressive effect on tree transpiration (E). Foliar water uptake increased in magnitude with drier soil and during longer leaf-wetting events. The difference between diurnal and nocturnal stomatal behaviour in D. brasiliensis could be attributed to an optimization of carbon gain when leaves are dry, as well as minimization of nocturnal water loss. The leaf-wetting events on the other hand seem important to D. brasiliensis water balance, especially during soil droughts, both by suppressing tree transpiration (E) and as a small additional water supply through FWU. Our results suggest that decreases in leaf-wetting events in TMCF might increase D. brasiliensis water loss and decrease its water gains, which could compromise its ecophysiological performance and survival during dry periods.
Resumo:
Objective Patients with mesial temporal lobe epilepsy (MTLE) may present unstable pattern of seizures. We aimed to evaluate the occurrence of relapse-remitting seizures in MTLE with (MTLE-HS) and without (MTLE-NL) hippocampal sclerosis. Method We evaluated 172 patients with MTLE-HS (122) or MTLE-NL (50). Relapse-remitting pattern was defined as periods longer than two years of seizure-freedom intercalated with seizure recurrence. Infrequent seizures was considered as up to three seizures per year and frequent seizures as any period of seizures higher than that. Results Thirty-seven (30%) MTLE-HS and 18 (36%) MTLE-NL patients had relapse-remitting pattern (X2, p = 0.470). This was more common in those with infrequent seizures (X2, p < 0.001). Twelve MTLE-HS and one MTLE-NL patients had prolonged seizure remission between the first and second decade of life (X2, p = 0.06). Conclusion Similar proportion of MTLE-HS or MTLE-NL patients present relapse-remitting seizures and this occurs more often in those with infrequent seizures.
Resumo:
Remotely sensed imagery has been widely used for land use/cover classification thanks to the periodic data acquisition and the widespread use of digital image processing systems offering a wide range of classification algorithms. The aim of this work was to evaluate some of the most commonly used supervised and unsupervised classification algorithms under different landscape patterns found in Rondônia, including (1) areas of mid-size farms, (2) fish-bone settlements and (3) a gradient of forest and Cerrado (Brazilian savannah). Comparison with a reference map based on the kappa statistics resulted in good to superior indicators (best results - K-means: k=0.68; k=0.77; k=0.64 and MaxVer: k=0.71; k=0.89; k=0.70 respectively for three areas mentioned). Results show that choosing a specific algorithm requires to take into account both its capacity to discriminate among various spectral signatures under different landscape patterns as well as a cost/benefit analysis considering the different steps performed by the operator performing a land cover/use map. it is suggested that a more systematic assessment of several options of implementation of a specific project is needed prior to beginning a land use/cover mapping job.
Resumo:
Brazil is an important poultry meat export country, and large parts of its destination are countries with specific rearing restrictions related to broiler s welfare. One of the aerial pollutants mostly found in high concentrations in closed poultry housing environment is ammonia. There are evidences that broilers welfare may be compromised by the continuous exposition to this pollutant in rearing housing. This research aimed to estimate broilers welfare reared under specific thermal environmental attributes and bird s density, as function of the ammonia concentration and light intensity inside the housing environment using the Fuzzy Theory. Results showed that the best welfare value (0.89 in the scale: 0-1) approximately 90% of the ideal was found in the conditions that associated the ideal thermal environment, with bird s density between 13-15 birds m-2, with values of the ammonia concentration in the environment below 5 ppm, and light intensity near 1 lx. Using the predictive method it was possible to estimate broilers welfare with relation to the ammonia concentration and light intensity in the housing.
Resumo:
This paper investigates the relationship between structural and semantic properties of factive sentences and the pattern of extraction exhibited. It is argued that a classification as weak or strong island is unfeasible for what has been termed Factive Island. The kinds of structures allowed as factive complements are analyzed as well as their corresponding behavior concerning extraction. The common feature these structures show is their presuppositional character, which is derived from a selection requirement. I assume that factive predicates select a [+ specific] complement. The differences showed concerning extraction constitute a spontaneous effect from the structural way each construction may satisfy this requirement.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.