13 resultados para Sparse Coding, Anomaly Detection, Dynamic Texture, Dantzig Selector, Compressed sensing
em Reposit
Resumo:
Diabetic Retinopathy (DR) is a complication of diabetes that can lead to blindness if not readily discovered. Automated screening algorithms have the potential to improve identification of patients who need further medical attention. However, the identification of lesions must be accurate to be useful for clinical application. The bag-of-visual-words (BoVW) algorithm employs a maximum-margin classifier in a flexible framework that is able to detect the most common DR-related lesions such as microaneurysms, cotton-wool spots and hard exudates. BoVW allows to bypass the need for pre- and post-processing of the retinographic images, as well as the need of specific ad hoc techniques for identification of each type of lesion. An extensive evaluation of the BoVW model, using three large retinograph datasets (DR1, DR2 and Messidor) with different resolution and collected by different healthcare personnel, was performed. The results demonstrate that the BoVW classification approach can identify different lesions within an image without having to utilize different algorithms for each lesion reducing processing time and providing a more flexible diagnostic system. Our BoVW scheme is based on sparse low-level feature detection with a Speeded-Up Robust Features (SURF) local descriptor, and mid-level features based on semi-soft coding with max pooling. The best BoVW representation for retinal image classification was an area under the receiver operating characteristic curve (AUC-ROC) of 97.8% (exudates) and 93.5% (red lesions), applying a cross-dataset validation protocol. To assess the accuracy for detecting cases that require referral within one year, the sparse extraction technique associated with semi-soft coding and max pooling obtained an AUC of 94.2 ± 2.0%, outperforming current methods. Those results indicate that, for retinal image classification tasks in clinical practice, BoVW is equal and, in some instances, surpasses results obtained using dense detection (widely believed to be the best choice in many vision problems) for the low-level descriptors.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Current data indicate that the size of high-density lipoprotein (HDL) may be considered an important marker for cardiovascular disease risk. We established reference values of mean HDL size and volume in an asymptomatic representative Brazilian population sample (n=590) and their associations with metabolic parameters by gender. Size and volume were determined in HDL isolated from plasma by polyethyleneglycol precipitation of apoB-containing lipoproteins and measured using the dynamic light scattering (DLS) technique. Although the gender and age distributions agreed with other studies, the mean HDL size reference value was slightly lower than in some other populations. Both HDL size and volume were influenced by gender and varied according to age. HDL size was associated with age and HDL-C (total population); non- white ethnicity and CETP inversely (females); HDL-C and PLTP mass (males). On the other hand, HDL volume was determined only by HDL-C (total population and in both genders) and by PLTP mass (males). The reference values for mean HDL size and volume using the DLS technique were established in an asymptomatic and representative Brazilian population sample, as well as their related metabolic factors. HDL-C was a major determinant of HDL size and volume, which were differently modulated in females and in males.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
Growth in the development and production of engineered nanoparticles (ENPs) in recent years has increased the potential for interactions of these nanomaterials with aquatic and terrestrial environments. Carefully designed studies are therefore required in order to understand the fate, transport, stability, and toxicity of nanoparticles. Natural organic matter (NOM), such as the humic substances found in water, sediment, and soil, is one of the substances capable of interacting with ENPs. This review presents the findings of studies of the interaction of ENPs and NOM, and the possible effects on nanoparticle stability and the toxicity of these materials in the environment. In addition, ENPs and NOM are utilized for many different purposes, including the removal of metals and organic compounds from effluents, and the development of new electronic sensors and other devices for the detection of active substances. Discussion is therefore provided of some of the ways in which NOM can be used in the production of nanoparticles. Although there has been an increase in the number of studies in this area, further progress is needed to improve understanding of the dynamic interactions between ENPs and NOM.
Resumo:
The objective of this study is to verify the dynamics between fiscal policy, measured by public debt, and monetary policy, measured by a reaction function of a central bank. Changes in monetary policies due to deviations from their targets always generate fiscal impacts. We examine two policy reaction functions: the first related to inflation targets and the second related to economic growth targets. We find that the condition for stable equilibrium is more restrictive in the first case than in the second. We then apply our simulation model to Brazil and United Kingdom and find that the equilibrium is unstable in the Brazilian case but stable in the UK case.
Resumo:
Cancer is a multistep process that begins with the transformation of normal epithelial cells and continues with tumor growth, stromal invasion and metastasis. The remodeling of the peritumoral environment is decisive for the onset of tumor invasiveness. This event is dependent on epithelial-stromal interactions, degradation of extracellular matrix components and reorganization of fibrillar components. Our research group has studied in a new proposed rodent model the participation of cellular and molecular components in the prostate microenvironment that contributes to cancer progression. Our group adopted the gerbil Meriones unguiculatus as an alternative experimental model for prostate cancer study. This model has presented significant responses to hormonal treatments and to development of spontaneous and induced neoplasias. The data obtained indicate reorganization of type I collagen fibers and reticular fibers, synthesis of new components such as tenascin and proteoglycans, degradation of basement membrane components and elastic fibers and increased expression of metalloproteinases. Fibroblasts that border the region, apparently participate in the stromal reaction. The roles of each of these events, as well as some signaling molecules, participants of neoplastic progression and factors that promote genetic reprogramming during epithelial-stromal transition are also discussed.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação FÃsica
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação FÃsica