12 resultados para Sequence Detection

em Reposit


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The actinobacterium Streptomyces wadayamensis A23 is an endophyte of Citrus reticulata that produces the antimycin and mannopeptimycin antibiotics, among others. The strain has the capability to inhibit Xylella fastidiosa growth. The draft genome of S. wadayamensis A23 has ~7.0 Mb and 6,006 protein-coding sequences, with a 73.5% G+C content.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Bacillus safensis is a microorganism recognized for its biotechnological and industrial potential due to its interesting enzymatic portfolio. Here, as a means of gathering information about the importance of this species in oil biodegradation, we report a draft genome sequence of a strain isolated from petroleum.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Avian pathogenic Escherichia coli (APEC) strains belong to a category that is associated with colibacillosis, a serious illness in the poultry industry worldwide. Additionally, some APEC groups have recently been described as potential zoonotic agents. In this work, we compared APEC strains with extraintestinal pathogenic E. coli (ExPEC) strains isolated from clinical cases of humans with extra-intestinal diseases such as urinary tract infections (UTI) and bacteremia. PCR results showed that genes usually found in the ColV plasmid (tsh, iucA, iss, and hlyF) were associated with APEC strains while fyuA, irp-2, fepC sitDchrom, fimH, crl, csgA, afa, iha, sat, hlyA, hra, cnf1, kpsMTII, clpVSakai and malX were associated with human ExPEC. Both categories shared nine serogroups (O2, O6, O7, O8, O11, O19, O25, O73 and O153) and seven sequence types (ST10, ST88, ST93, ST117, ST131, ST155, ST359, ST648 and ST1011). Interestingly, ST95, which is associated with the zoonotic potential of APEC and is spread in avian E. coli of North America and Europe, was not detected among 76 APEC strains. When the strains were clustered based on the presence of virulence genes, most ExPEC strains (71.7%) were contained in one cluster while most APEC strains (63.2%) segregated to another. In general, the strains showed distinct genetic and fingerprint patterns, but avian and human strains of ST359, or ST23 clonal complex (CC), presented more than 70% of similarity by PFGE. The results demonstrate that some zoonotic-related STs (ST117, ST131, ST10CC, ST23CC) are present in Brazil. Also, the presence of moderate fingerprint similarities between ST359 E. coli of avian and human origin indicates that strains of this ST are candidates for having zoonotic potential.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A Bacillus cereus strain, FT9, isolated from a hot spring in the midwest region of Brazil, had its entire genome sequenced.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A monomeric basic PLA2 (PhTX-II) of 14149.08 Da molecular weight was purified to homogeneity from Porthidium hyoprora venom. Amino acid sequence by in tandem mass spectrometry revealed that PhTX-II belongs to Asp49 PLA2 enzyme class and displays conserved domains as the catalytic network, Ca2+-binding loop and the hydrophobic channel of access to the catalytic site, reflected in the high catalytic activity displayed by the enzyme. Moreover, PhTX-II PLA2 showed an allosteric behavior and its enzymatic activity was dependent on Ca2+. Examination of PhTX-II PLA2 by CD spectroscopy indicated a high content of alpha-helical structures, similar to the known structure of secreted phospholipase IIA group suggesting a similar folding. PhTX-II PLA2 causes neuromuscular blockade in avian neuromuscular preparations with a significant direct action on skeletal muscle function, as well as, induced local edema and myotoxicity, in mice. The treatment of PhTX-II by BPB resulted in complete loss of their catalytic activity that was accompanied by loss of their edematogenic effect. On the other hand, enzymatic activity of PhTX-II contributes to this neuromuscular blockade and local myotoxicity is dependent not only on enzymatic activity. These results show that PhTX-II is a myotoxic Asp49 PLA2 that contributes with toxic actions caused by P. hyoprora venom.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Telomerase RNAs (TERs) are highly divergent between species, varying in size and sequence composition. Here, we identify a candidate for the telomerase RNA component of Leishmania genus, which includes species that cause leishmaniasis, a neglected tropical disease. Merging a thorough computational screening combined with RNA-seq evidence, we mapped a non-coding RNA gene localized in a syntenic locus on chromosome 25 of five Leishmania species that shares partial synteny with both Trypanosoma brucei TER locus and a putative TER candidate-containing locus of Crithidia fasciculata. Using target-driven molecular biology approaches, we detected a ∼2,100 nt transcript (LeishTER) that contains a 5' spliced leader (SL) cap, a putative 3' polyA tail and a predicted C/D box snoRNA domain. LeishTER is expressed at similar levels in the logarithmic and stationary growth phases of promastigote forms. A 5'SL capped LeishTER co-immunoprecipitated and co-localized with the telomerase protein component (TERT) in a cell cycle-dependent manner. Prediction of its secondary structure strongly suggests the existence of a bona fide single-stranded template sequence and a conserved C[U/C]GUCA motif-containing helix II, representing the template boundary element. This study paves the way for further investigations on the biogenesis of parasite TERT ribonucleoproteins (RNPs) and its role in parasite telomere biology.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.