10 resultados para Process Monitoring
em Reposit
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Quantification of dermal exposure to pesticides in rural workers, used in risk assessment, can be performed with different techniques such as patches or whole body evaluation. However, the wide variety of methods can jeopardize the process by producing disparate results, depending on the principles in sample collection. A critical review was thus performed on the main techniques for quantifying dermal exposure, calling attention to this issue and the need to establish a single methodology for quantification of dermal exposure in rural workers. Such harmonization of different techniques should help achieve safer and healthier working conditions. Techniques that can provide reliable exposure data are an essential first step towards avoiding harm to workers' health.
Resumo:
Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.
Resumo:
20
Resumo:
Process Analytical Chemistry (PAC) is an important and growing area in analytical chemistry, that has received little attention in academic centers devoted to the gathering of knowledge and to optimization of chemical processes. PAC is an area devoted to optimization and knowledge acquisition of chemical processes, to reducing costs and wastes and to making an important contribution to sustainable development. The main aim of this review is to present to the Brazilian community the development and state of the art of PAC, discussing concepts, analytical techniques currently employed in the industry and some applications.
Resumo:
Behavioral adjustments may occur fast and with less cost than the physiological adaptations. Considering the social behavior is suggestive that the frequency and the intensity of aggressive interactions, the total social cohesion and the extent of vicious attitudes may be used to evaluate welfare. This research presents an analysis of the interactions between the experimental factors such as temperature, genetic and time of the day in the behavior of female broiler breeders under controlled environment in a climatic chamber in order to enhance the different reaction of the birds facing distinct environmental conditions. The results showed significant differences between the behaviors expressed by the studied genetics presenting the need of monitoring them in real-time in order to predict their welfare in commercial housing, due to the complexity of the environmental variables that interfere in the well being process. The research also concluded that the welfare evaluation of female broiler breeders needs to consider the time of the day during the observation of the behaviors.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física