Monitoramento de parâmetros imunológicos em atletas adolescentes de basquetebol durante e após a temporada esportiva= : Monitoring of immunological parameters in adolescent basketball athletes during and after a sports season

Universidade Estadual de Campinas . Faculdade de Educação Física

Ihwg-μnir: A Miniaturised Near-infrared Gas Sensor Based On Substrate-integrated Hollow Waveguides Coupled To A Micro-nir-spectrophotometer.

A miniaturised gas analyser is described and evaluated based on the use of a substrate-integrated hollow waveguide (iHWG) coupled to a microsized near-infrared spectrophotometer comprising a linear variable filter and an array of InGaAs detectors. This gas sensing system was applied to analyse surrogate samples of natural fuel gas containing methane, ethane, propane and butane, quantified by using multivariate regression models based on partial least square (PLS) algorithms and Savitzky-Golay 1(st) derivative data preprocessing. The external validation of the obtained models reveals root mean square errors of prediction of 0.37, 0.36, 0.67 and 0.37% (v/v), for methane, ethane, propane and butane, respectively. The developed sensing system provides particularly rapid response times upon composition changes of the gaseous sample (approximately 2 s) due the minute volume of the iHWG-based measurement cell. The sensing system developed in this study is fully portable with a hand-held sized analyser footprint, and thus ideally suited for field analysis. Last but not least, the obtained results corroborate the potential of NIR-iHWG analysers for monitoring the quality of natural gas and petrochemical gaseous products.

[health Protection For Rural Workers: The Need To Standardize Techniques For Quantifying Dermal Exposure To Pesticides].

Quantification of dermal exposure to pesticides in rural workers, used in risk assessment, can be performed with different techniques such as patches or whole body evaluation. However, the wide variety of methods can jeopardize the process by producing disparate results, depending on the principles in sample collection. A critical review was thus performed on the main techniques for quantifying dermal exposure, calling attention to this issue and the need to establish a single methodology for quantification of dermal exposure in rural workers. Such harmonization of different techniques should help achieve safer and healthier working conditions. Techniques that can provide reliable exposure data are an essential first step towards avoiding harm to workers' health.

Study Of The Homogeneity Of Drug Loaded In Polymeric Films Using Near-infrared Chemical Imaging And Split-plot Design.

Split-plot design (SPD) and near-infrared chemical imaging were used to study the homogeneity of the drug paracetamol loaded in films and prepared from mixtures of the biocompatible polymers hydroxypropyl methylcellulose, polyvinylpyrrolidone, and polyethyleneglycol. The study was split into two parts: a partial least-squares (PLS) model was developed for a pixel-to-pixel quantification of the drug loaded into films. Afterwards, a SPD was developed to study the influence of the polymeric composition of films and the two process conditions related to their preparation (percentage of the drug in the formulations and curing temperature) on the homogeneity of the drug dispersed in the polymeric matrix. Chemical images of each formulation of the SPD were obtained by pixel-to-pixel predictions of the drug using the PLS model of the first part, and macropixel analyses were performed for each image to obtain the y-responses (homogeneity parameter). The design was modeled using PLS regression, allowing only the most relevant factors to remain in the final model. The interpretation of the SPD was enhanced by utilizing the orthogonal PLS algorithm, where the y-orthogonal variations in the design were separated from the y-correlated variation.

Censored Linear Regression Models For Irregularly Observed Longitudinal Data Using The Multivariate-t Distribution.

In acquired immunodeficiency syndrome (AIDS) studies it is quite common to observe viral load measurements collected irregularly over time. Moreover, these measurements can be subjected to some upper and/or lower detection limits depending on the quantification assays. A complication arises when these continuous repeated measures have a heavy-tailed behavior. For such data structures, we propose a robust structure for a censored linear model based on the multivariate Student's t-distribution. To compensate for the autocorrelation existing among irregularly observed measures, a damped exponential correlation structure is employed. An efficient expectation maximization type algorithm is developed for computing the maximum likelihood estimates, obtaining as a by-product the standard errors of the fixed effects and the log-likelihood function. The proposed algorithm uses closed-form expressions at the E-step that rely on formulas for the mean and variance of a truncated multivariate Student's t-distribution. The methodology is illustrated through an application to an Human Immunodeficiency Virus-AIDS (HIV-AIDS) study and several simulation studies.

Deregulation Of Adipokines Related To Target Organ Damage On Resistant Hypertension.

Resistant hypertension (RHTN) includes patients with controlled blood pressure (BP) (CRHTN) and uncontrolled BP (UCRHTN). In fact, RHTN patients are more likely to have target organ damage (TOD), and resistin, leptin and adiponectin may affect BP control in these subjects. We assessed the relationship between adipokines levels and arterial stiffness, left ventricular hypertrophy (LVH) and microalbuminuria (MA). This cross-sectional study included CRHTN (n=51) and UCRHTN (n=38) patients for evaluating body mass index, ambulatory blood pressure monitoring, plasma adiponectin, leptin and resistin concentrations, pulse wave velocity (PWV), MA and echocardiography. Leptin and resistin levels were higher in UCRHTN, whereas adiponectin levels were lower in this same subgroup. Similarly, arterial stiffness, LVH and MA were higher in UCRHTN subgroup. Adiponectin levels negatively correlated with PWV (r=-0.42, P<0.01), and MA (r=-0.48, P<0.01) only in UCRHTN. Leptin was positively correlated with PWV (r=0.37, P=0.02) in UCRHTN subgroup, whereas resistin was not correlated with TOD in both subgroups. Adiponectin is associated with arterial stiffness and renal injury in UCRHTN patients, whereas leptin is associated with arterial stiffness in the same subgroup. Taken together, our results showed that those adipokines may contribute to vascular and renal damage in UCRHTN patients.

[meanings Of The Sickening Process For Patients With Systemic Lupus Erythematosus: A Review Of The Literature.]

Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.

[in Process Citation].

20

Comparing Near-infrared Conventional Diffuse Reflectance Spectroscopy And Hyperspectral Imaging For Determination Of The Bulk Properties Of Solid Samples By Multivariate Regression: Determination Of Mooney Viscosity And Plasticity Indices Of Natural Rubber.

Conventional reflectance spectroscopy (NIRS) and hyperspectral imaging (HI) in the near-infrared region (1000-2500 nm) are evaluated and compared, using, as the case study, the determination of relevant properties related to the quality of natural rubber. Mooney viscosity (MV) and plasticity indices (PI) (PI0 - original plasticity, PI30 - plasticity after accelerated aging, and PRI - the plasticity retention index after accelerated aging) of rubber were determined using multivariate regression models. Two hundred and eighty six samples of rubber were measured using conventional and hyperspectral near-infrared imaging reflectance instruments in the range of 1000-2500 nm. The sample set was split into regression (n = 191) and external validation (n = 95) sub-sets. Three instruments were employed for data acquisition: a line scanning hyperspectral camera and two conventional FT-NIR spectrometers. Sample heterogeneity was evaluated using hyperspectral images obtained with a resolution of 150 × 150 μm and principal component analysis. The probed sample area (5 cm(2); 24,000 pixels) to achieve representativeness was found to be equivalent to the average of 6 spectra for a 1 cm diameter probing circular window of one FT-NIR instrument. The other spectrophotometer can probe the whole sample in only one measurement. The results show that the rubber properties can be determined with very similar accuracy and precision by Partial Least Square (PLS) regression models regardless of whether HI-NIR or conventional FT-NIR produce the spectral datasets. The best Root Mean Square Errors of Prediction (RMSEPs) of external validation for MV, PI0, PI30, and PRI were 4.3, 1.8, 3.4, and 5.3%, respectively. Though the quantitative results provided by the three instruments can be considered equivalent, the hyperspectral imaging instrument presents a number of advantages, being about 6 times faster than conventional bulk spectrometers, producing robust spectral data by ensuring sample representativeness, and minimizing the effect of the presence of contaminants.

Química Analítica de Processos

Process Analytical Chemistry (PAC) is an important and growing area in analytical chemistry, that has received little attention in academic centers devoted to the gathering of knowledge and to optimization of chemical processes. PAC is an area devoted to optimization and knowledge acquisition of chemical processes, to reducing costs and wastes and to making an important contribution to sustainable development. The main aim of this review is to present to the Brazilian community the development and state of the art of PAC, discussing concepts, analytical techniques currently employed in the industry and some applications.

Efeitos da temperatura do ar, linhagem e período do dia nas freqüências de ocorrências e tempos de expressão comportamental de matrizes pesadas

Behavioral adjustments may occur fast and with less cost than the physiological adaptations. Considering the social behavior is suggestive that the frequency and the intensity of aggressive interactions, the total social cohesion and the extent of vicious attitudes may be used to evaluate welfare. This research presents an analysis of the interactions between the experimental factors such as temperature, genetic and time of the day in the behavior of female broiler breeders under controlled environment in a climatic chamber in order to enhance the different reaction of the birds facing distinct environmental conditions. The results showed significant differences between the behaviors expressed by the studied genetics presenting the need of monitoring them in real-time in order to predict their welfare in commercial housing, due to the complexity of the environmental variables that interfere in the well being process. The research also concluded that the welfare evaluation of female broiler breeders needs to consider the time of the day during the observation of the behaviors.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Auto-eficácia docente e motivação para a realização do(a) professor(a) de Educação Física Adaptada

Universidade Estadual de Campinas . Faculdade de Educação Física

Praticas socioculturais, poder e diferenciação em Bico, Cuiamucu e Canela-Fina - comunidades amazonicas

Universidade Estadual de Campinas . Faculdade de Educação Física

Utilização da discriminação grafica de Fisher para indicação dos dermatoglifos como referencial de potencialidade de atletas de basquetebol

Universidade Estadual de Campinas. Faculdade de Educação Física