6 resultados para Impact Assessments and Monitoring of policies
em Reposit
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
This study sought to evaluate the association between the impact of oral disorders in terms of physical/psychosocial dimensions and quality of life among the elderly. It involved a cross-sectional study conducted among the elderly (65-74 years) in 2008/2009. The social impact was assessed using the Oral Health Impact Profile (OHIP 14) and the quality of life using the SF 12 Short-Form Health Survey. Descriptive, univariate and multivariate (logistic regression) analysis was conducted with correction for the design effect, using SPSS(r)18.0 software. Of the 800 individuals approached, 736 elderly individuals participated (TR = 92%), with a mean age of 67.77 years, the majority of whom showed no impact based on the measurement of the prevalence of OHIP. The functional limitation dimension of the OHIP was associated with the physical domain of the SF12, irrespective of the other variables investigated. However, the seriousness of OHIP and its psychological discomfort and disability dimensions was associated with the mental domain of the SF12. The conclusion reached is that some impacts of oral disorders were associated with unsatisfactory quality of life in the physical and mental domains.
Resumo:
Chronic myeloid leukemia (CML) requires strict daily compliance with oral medication and regular blood and bone marrow control tests. The objective was to evaluate CML patients' perceptions about the disease, their access to information regarding the diagnosis, monitoring and treatment, adverse effects and associations of these variables with patients' demographics, region and healthcare access. Prospective cross-sectional study among CML patients registered with the Brazilian Lymphoma and Leukemia Association (ABRALE). CML patients receiving treatment through the public healthcare system were interviewed by telephone. Among 1,102 patients interviewed, the symptoms most frequently leading them to seek medical care were weakness or fatigue. One third were diagnosed by means of routine tests. The time that elapsed between first symptoms and seeking medical care was 42.28 ± 154.21 days. Most patients had been tested at least once for Philadelphia chromosome, but 43.2% did not know the results. 64.8% had had polymerase chain reaction testing for the BCR/ABL gene every three months. 47% believed that CML could be controlled, but 33.1% believed that there was no treatment. About 24% reported occasionally stopping their medication. Imatinib was associated with nausea, cramps and muscle pain. Self-reported treatment adherence was significantly associated with normalized blood count, and positively associated with imatinib. There is a lack of information or understanding about disease monitoring tools among Brazilian CML patients; they are diagnosed quickly and have good access to treatment. Correct comprehension of CML control tools is impaired in Brazilian patients.
Resumo:
All-trans retinoic acid (atRA) maintains physiological stability of the prostate, and we reported that ethanol intake increases atRA in the rat prostate; however the mechanisms underlying these changes are unknown. We evaluated the impact of a low- and high-dose ethanol intake (UChA and UChB strains) on atRA metabolism in the dorsal and lateral prostate. Aldehyde dehydrogenase (ALDH) subtype 1A3 was increased in the dorsal prostate of UChA animals while ALDH1A1 and ALDH1A2 decreased in the lateral prostate. In UChB animals, ALDH1A1, ALDH1A2, and ALDH1A3 increased in the dorsal prostate, and ALDH1A3 decreased in the lateral prostate. atRA levels increased with the low activity of CYP2E1 and decreased with high CYP26 activity in the UChB dorsal prostate. Conversely, atRA was found to decrease when the activity of total CYP was increased in the UChA lateral prostate. Ethanol modulates the synthesis and catabolism of atRA in the prostate in a concentration-dependent manner.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física