8 resultados para INFECTED ERYTHROCYTES

em Reposit


Relevância:

20.00% 20.00%

Publicador:

Resumo:

In the Amazon Region, there is a virtual absence of severe malaria and few fatal cases of naturally occurring Plasmodium falciparum infections; this presents an intriguing and underexplored area of research. In addition to the rapid access of infected persons to effective treatment, one cause of this phenomenon might be the recognition of cytoadherent variant proteins on the infected red blood cell (IRBC) surface, including the var gene encoded P. falciparum erythrocyte membrane protein 1. In order to establish a link between cytoadherence, IRBC surface antibody recognition and the presence or absence of malaria symptoms, we phenotype-selected four Amazonian P. falciparum isolates and the laboratory strain 3D7 for their cytoadherence to CD36 and ICAM1 expressed on CHO cells. We then mapped the dominantly expressed var transcripts and tested whether antibodies from symptomatic or asymptomatic infections showed a differential recognition of the IRBC surface. As controls, the 3D7 lineages expressing severe disease-associated phenotypes were used. We showed that there was no profound difference between the frequency and intensity of antibody recognition of the IRBC-exposed P. falciparum proteins in symptomatic vs. asymptomatic infections. The 3D7 lineages, which expressed severe malaria-associated phenotypes, were strongly recognised by most, but not all plasmas, meaning that the recognition of these phenotypes is frequent in asymptomatic carriers, but is not necessarily a prerequisite to staying free of symptoms.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

β-Carotene, zeaxanthin, lutein, β-cryptoxanthin, and lycopene are liposoluble pigments widely distributed in vegetables and fruits and, after ingestion, these compounds are usually detected in human blood plasma. In this study, we evaluated their potential to inhibit hemolysis of human erythrocytes, as mediated by the toxicity of peroxyl radicals (ROO•). Thus, 2,2'-azobis (2-methylpropionamidine) dihydrochloride (AAPH) was used as ROO• generator and the hemolysis assay was carried out in experimental conditions optimized by response surface methodology, and successfully adapted to microplate assay. The optimized conditions were verified at 30 × 10(6) cells/mL, 17 mM of AAPH for 3 h, at which 48 ± 5% of hemolysis was achieved in freshly isolated erythrocytes. Among the tested carotenoids, lycopene (IC(50) = 0.24 ± 0.05 μM) was the most efficient to prevent the hemolysis, followed by β-carotene (0.32 ± 0.02 μM), lutein (0.38 ± 0.02 μM), and zeaxanthin (0.43 ± 0.02 μM). These carotenoids were at least 5 times more effective than quercetin, trolox, and ascorbic acid (positive controls). β-Cryptoxanthin did not present any erythroprotective effect, but rather induced a hemolytic effect at the highest tested concentration (3 μM). These results suggest that selected carotenoids may have potential to act as important erythroprotective agents by preventing ROO•-induced toxicity in human erythrocytes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Membrane microdomains enriched in cholesterol, sphingolipids (rafts), and specific proteins are involved in important physiological functions. However their structure, size and stability are still controversial. Given that detergent-resistant membranes (DRMs) are in the liquid-ordered state and are rich in raft-like components, they might correspond to rafts at least to some extent. Here we monitor the lateral order of biological membranes by characterizing DRMs from erythrocytes obtained with Brij-98, Brij-58, and TX-100 at 4 °C and 37 °C. All DRMs were enriched in cholesterol and contained the raft markers flotillin-2 and stomatin. However, sphingomyelin (SM) was only found to be enriched in TX-100-DRMs - a detergent that preferentially solubilizes the membrane inner leaflet - while Band 3 was present solely in Brij-DRMs. Electron paramagnetic resonance spectra showed that the acyl chain packing of Brij-DRMs was lower than TX-100-DRMs, providing evidence of their diverse lipid composition. Fatty acid analysis revealed that the SM fraction of the DRMs was enriched in lignoceric acid, which should specifically contribute to the resistance of SM to detergents. These results indicate that lipids from the outer leaflet, particularly SM, are essential for the formation of the liquid-ordered phase of DRMs. At last, the differential solubilization process induced by Brij-98 and TX-100 was monitored using giant unilamellar vesicles. This study suggests that Brij and TX-100-DRMs reflect different degrees of lateral order of the membrane microdomains. Additionally, Brij DRMs are composed by both inner and outer leaflet components, making them more physiologically relevant than TX-100-DRMs to the studies of membrane rafts.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reports of long-term tenofovir disoproxil fumarate (TDF) treatment in HIV-infected adolescents are limited. We present final results from the open-label (OL) TDF extension following the randomized, placebo (PBO)-controlled, double-blind phase of GS-US-104-0321 (Study 321). HIV-infected 12- to 17-year-olds treated with TDF 300 mg or PBO with an optimized background regimen (OBR) for 24-48 weeks subsequently received OL TDF plus OBR in a single arm study extension. HIV-1 RNA and safety, including bone mineral density (BMD), was assessed in all TDF recipients. Eighty-one subjects received TDF (median duration 96 weeks). No subject died or discontinued OL TDF for safety/tolerability. At week 144, proportions with HIV-1 RNA <50 copies/mL were 30.4% (7 of 23 subjects with baseline HIV-1 RNA >1000 c/mL initially randomized to TDF), 41.7% (5 of 12 subjects with HIV-1 RNA <1000 c/mL who switched PBO to TDF) and 0% (0 of 2 subjects failed randomized PBO plus OBR with HIV-1 RNA >1000 c/mL and switched PBO to TDF). Viral resistance to TDF occurred in 1 subject. At week 144, median decrease in estimated glomerular filtration rate was 38.1 mL/min/1.73 m (n = 25). Increases in median spine (+12.70%, n = 26) and total body less head BMD (+4.32%, n = 26) and height-age adjusted Z-scores (n = 21; +0.457 for spine, +0.152 for total body less head) were observed at week 144. Five of 81 subjects (6%) had persistent >4% BMD decreases from baseline. Some subjects had virologic responses to TDF plus OBR, and TDF resistance was rare. TDF was well tolerated and can be considered for treatment of HIV-infected adolescents.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Low bone mineral density (BMD) has been found in human immunodeficiency virus (HIV)-infected patients; however, data on associated factors remain unclear, specifically in middle-aged women. This study aims to evaluate factors associated with low BMD in HIV-positive women. In this cross-sectional study, a questionnaire was administered to 206 HIV-positive women aged 40 to 60 years who were receiving outpatient care. Clinical features, laboratory test results, and BMD were assessed. Yates and Pearson χ(2) tests and Poisson multiple regression analysis were performed. The median age of women was 47.7 years; 75% had nadir CD4 T-cell counts higher than 200, and 77.8% had viral loads below the detection limit. There was no association between low BMD at the proximal femur and lumbar spine (L1-L4) and risk factors associated with HIV infection and highly active antiretroviral therapy. Poisson multiple regression analysis showed that the only factor associated with low BMD at the proximal femur and lumbar spine was postmenopause status. Low BMD is present in more than one third of this population sample, in which most women are using highly active antiretroviral therapy and have a well-controlled disease. The main associated factor is related to estrogen deprivation. The present data support periodic BMD assessments in HIV-infected patients and highlight the need to implement comprehensive menopausal care for these women to prevent bone loss.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study investigated the presence of target bacterial species and the levels of endotoxins in teeth with apical periodontitis. Levels of inflammatory mediators (interleukin [IL]-1β and tumor necrosis factor [TNF]-α) were determined after macrophage stimulation with endodontic content after different phases of endodontic therapy using different irrigants. Thirty primarily infected root canals were randomly assigned into 3 groups according to the irrigant used for root canal preparation (n = 10 per group): GI: 2.5% sodium hypochlorite, GII: 2% chlorhexidine gel, and GIII (control group): saline solution. Root canal samples were taken by using paper points before (s1) and after root canal instrumentation (s2), subsequently to 17% EDTA (s3), after 30 days of intracanal medication (Ca[OH]2 + saline solution) (s4), and before root canal obturation (s5). Polymerase chain reaction (16S recombinant DNA) and limulus amebocyte lysate assay were used for bacterial and endotoxin detection, respectively. Macrophages were stimulated with the root canal contents for IL-1β/TNF-α measurement using enzyme-linked immunosorbent assay. Porphyromonas gingivalis (17/30), Porphyromonas endodontalis (15/30), and Prevotella nigrescens (11/30) were the most prevalent bacterial species. At s1, endotoxins were detected in 100% of the root canals (median = 32.43 EU/mL). In parallel, substantial amounts of IL-1β and TNF-α were produced by endodontic content-stimulated macrophages. At s2, a significant reduction in endotoxin levels was observed in all groups, with GI presenting the greatest reduction (P < .05). After a root canal rinse with EDTA (s3), intracanal medication (s4), and before root canal obturation (s5), endotoxin levels reduced without differences between groups (P < .05). IL-1β and TNF-α release decreased proportionally to the levels of residual endotoxin (P < .05). Regardless of the use of sodium hypochlorite or CHX, the greatest endotoxin reduction occurs after chemomechanical preparation. Increasing steps of root canal therapy associated with intracanal medication enhances endotoxin reduction, leading to a progressively lower activation of proinflammatory cells such as macrophages.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

From 1992 to 1995 we studied 232 (69% male, 87% Caucasian) anti-human immunodeficiency virus (anti-HIV) positive Brazilian patients, through a questionnaire; HIV had been acquired sexually by 50%, from blood by 32%, sexually and/or from blood by 16.4% and by an unknown route by 1.7%. Intravenous drug use was reported by 29%; it was the most important risk factor for HIV transmission. The alanine aminotransferase quotient (qALT) was >1 for 40% of the patients, 93.6% had anti-hepatitis A virus antibody, 5.3% presented hepatitis B surface antigen, 44% were anti-hepatitis B core antigen positive and 53.8% were anti-hepatitis C virus (anti-HCV) positive. The anti-HCV test showed a significant association with qALT>1. Patients for whom the probable HIV transmission route was blood had a 10.8 times greater risk of being anti-HCV positive than patients infected by other routes. Among 30 patients submitted to liver biopsy, 18 presented chronic hepatitis.