4 resultados para Discrete Events Simulation

em Reposit


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Maxillofacial trauma resulting from falls in elderly patients is a major social and health care concern. Most of these traumatic events involve mandibular fractures. The aim of this study was to analyze stress distributions from traumatic loads applied on the symphyseal, parasymphyseal, and mandibular body regions in the elderly edentulous mandible using finite-element analysis (FEA). Computerized tomographic analysis of an edentulous macerated human mandible of a patient approximately 65 years old was performed. The bone structure was converted into a 3-dimensional stereolithographic model, which was used to construct the computer-aided design (CAD) geometry for FEA. The mechanical properties of cortical and cancellous bone were characterized as isotropic and elastic structures, respectively, in the CAD model. The condyles were constrained to prevent free movement in the x-, y-, and z-axes during simulation. This enabled the simulation to include the presence of masticatory muscles during trauma. Three different simulations were performed. Loads of 700 N were applied perpendicular to the surface of the cortical bone in the symphyseal, parasymphyseal, and mandibular body regions. The simulation results were evaluated according to equivalent von Mises stress distributions. Traumatic load at the symphyseal region generated low stress levels in the mental region and high stress levels in the mandibular neck. Traumatic load at the parasymphyseal region concentrated the resulting stress close to the mental foramen. Traumatic load in the mandibular body generated extensive stress in the mandibular body, angle, and ramus. FEA enabled precise mapping of the stress distribution in a human elderly edentulous mandible (neck and mandibular angle) in response to 3 different traumatic load conditions. This knowledge can help guide emergency responders as they evaluate patients after a traumatic event.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work, the energy response functions of a CdTe detector were obtained by Monte Carlo (MC) simulation in the energy range from 5 to 160keV, using the PENELOPE code. In the response calculations the carrier transport features and the detector resolution were included. The computed energy response function was validated through comparison with experimental results obtained with (241)Am and (152)Eu sources. In order to investigate the influence of the correction by the detector response at diagnostic energy range, x-ray spectra were measured using a CdTe detector (model XR-100T, Amptek), and then corrected by the energy response of the detector using the stripping procedure. Results showed that the CdTe exhibits good energy response at low energies (below 40keV), showing only small distortions on the measured spectra. For energies below about 80keV, the contribution of the escape of Cd- and Te-K x-rays produce significant distortions on the measured x-ray spectra. For higher energies, the most important correction is the detector efficiency and the carrier trapping effects. The results showed that, after correction by the energy response, the measured spectra are in good agreement with those provided by a theoretical model of the literature. Finally, our results showed that the detailed knowledge of the response function and a proper correction procedure are fundamental for achieving more accurate spectra from which quality parameters (i.e., half-value layer and homogeneity coefficient) can be determined.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.