11 resultados para Capacitively coupled contactless conductivity detection
em Reposit
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
A miniaturised gas analyser is described and evaluated based on the use of a substrate-integrated hollow waveguide (iHWG) coupled to a microsized near-infrared spectrophotometer comprising a linear variable filter and an array of InGaAs detectors. This gas sensing system was applied to analyse surrogate samples of natural fuel gas containing methane, ethane, propane and butane, quantified by using multivariate regression models based on partial least square (PLS) algorithms and Savitzky-Golay 1(st) derivative data preprocessing. The external validation of the obtained models reveals root mean square errors of prediction of 0.37, 0.36, 0.67 and 0.37% (v/v), for methane, ethane, propane and butane, respectively. The developed sensing system provides particularly rapid response times upon composition changes of the gaseous sample (approximately 2 s) due the minute volume of the iHWG-based measurement cell. The sensing system developed in this study is fully portable with a hand-held sized analyser footprint, and thus ideally suited for field analysis. Last but not least, the obtained results corroborate the potential of NIR-iHWG analysers for monitoring the quality of natural gas and petrochemical gaseous products.
Resumo:
Negative-ion mode electrospray ionization, ESI(-), with Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) was coupled to a Partial Least Squares (PLS) regression and variable selection methods to estimate the total acid number (TAN) of Brazilian crude oil samples. Generally, ESI(-)-FT-ICR mass spectra present a power of resolution of ca. 500,000 and a mass accuracy less than 1 ppm, producing a data matrix containing over 5700 variables per sample. These variables correspond to heteroatom-containing species detected as deprotonated molecules, [M - H](-) ions, which are identified primarily as naphthenic acids, phenols and carbazole analog species. The TAN values for all samples ranged from 0.06 to 3.61 mg of KOH g(-1). To facilitate the spectral interpretation, three methods of variable selection were studied: variable importance in the projection (VIP), interval partial least squares (iPLS) and elimination of uninformative variables (UVE). The UVE method seems to be more appropriate for selecting important variables, reducing the dimension of the variables to 183 and producing a root mean square error of prediction of 0.32 mg of KOH g(-1). By reducing the size of the data, it was possible to relate the selected variables with their corresponding molecular formulas, thus identifying the main chemical species responsible for the TAN values.
Resumo:
A rapid, sensitive and specific method for quantifying propylthiouracil in human plasma using methylthiouracil as the internal standard (IS) is described. The analyte and the IS were extracted from plasma by liquid-liquid extraction using an organic solvent (ethyl acetate). The extracts were analyzed by high performance liquid chromatography coupled with electrospray tandem mass spectrometry (HPLC-MS/MS) in negative mode (ES-). Chromatography was performed using a Phenomenex Gemini C18 5μm analytical column (4.6mm×150mm i.d.) and a mobile phase consisting of methanol/water/acetonitrile (40/40/20, v/v/v)+0.1% of formic acid. For propylthiouracil and I.S., the optimized parameters of the declustering potential, collision energy and collision exit potential were -60 (V), -26 (eV) and -5 (V), respectively. The method had a chromatographic run time of 2.5min and a linear calibration curve over the range 20-5000ng/mL. The limit of quantification was 20ng/mL. The stability tests indicated no significant degradation. This HPLC-MS/MS procedure was used to assess the bioequivalence of two propylthiouracil 100mg tablet formulations in healthy volunteers of both sexes in fasted and fed state. The geometric mean and 90% confidence interval CI of Test/Reference percent ratios were, without and with food, respectively: 109.28% (103.63-115.25%) and 115.60% (109.03-122.58%) for Cmax, 103.31% (100.74-105.96%) and 103.40% (101.03-105.84) for AUClast. This method offers advantages over those previously reported, in terms of both a simple liquid-liquid extraction without clean-up procedures, as well as a faster run time (2.5min). The LOQ of 20ng/mL is well suited for pharmacokinetic studies. The assay performance results indicate that the method is precise and accurate enough for the routine determination of the propylthiouracil in human plasma. The test formulation with and without food was bioequivalent to reference formulation. Food administration increased the Tmax and decreased the bioavailability (Cmax and AUC).
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
In recent years, agronomical researchers began to cultivate several olive varieties in different regions of Brazil to produce virgin olive oil (VOO). Because there has been no reported data regarding the phenolic profile of the first Brazilian VOO, the aim of this work was to determine phenolic contents of these samples using rapid-resolution liquid chromatography coupled to electrospray ionisation time-of-flight mass spectrometry. 25 VOO samples from Arbequina, Koroneiki, Arbosana, Grappolo, Manzanilla, Coratina, Frantoio and MGS Mariense varieties from three different Brazilian states and two crops were analysed. It was possible to quantify 19 phenolic compounds belonging to different classes. The results indicated that Brazilian VOOs have high total phenolic content because the values were comparable with those from high-quality VOOs produced in other countries. VOOs from Coratina, Arbosana and Grappolo presented the highest total phenolic content. These data will be useful in the development and improvement of Brazilian VOO.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The importance of medicinal plants and their use in industrial applications is increasing worldwide, especially in Brazil. Phyllanthus species, popularly known as quebra-pedras in Brazil, are used in folk medicine for treating urinary infections and renal calculus. This paper reports an authenticity study, based on herbal drugs from Phyllanthus species, involving commercial and authentic samples using spectroscopic techniques: FT-IR, ¹H HR-MAS NMR and ¹H NMR in solution, combined with chemometric analysis. The spectroscopic techniques evaluated, coupled with chemometric methods, have great potential in the investigation of complex matrices. Furthermore, several metabolites were identified by the NMR techniques.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.