Imported Malaria In A Non-endemic Area: The Experience Of The University Of Campinas Hospital In The Brazilian Southeast.

Although malaria in Brazil almost exclusively occurs within the boundaries of the Amazon Region, some concerns are raised regarding imported malaria to non-endemic areas of the country, notably increased incidence of complications due to delayed diagnoses. However, although imported malaria in Brazil represents a major health problem, only a few studies have addressed this subject. A retrospective case series is presented in which 263 medical charts were analysed to investigate the clinical and epidemiological characterization of malaria cases that were diagnosed and treated at Hospital & Clinics, State University of Campinas between 1998 and 2011. Amongst all medical charts analysed, 224 patients had a parasitological confirmed diagnosis of malaria. Plasmodium vivax and Plasmodium falciparum were responsible for 67% and 30% of the infections, respectively. The majority of patients were male (83%) of a productive age (median, 37 years old). Importantly, severe complications did not differ significantly between P. vivax (14 cases, 9%) and P. falciparum (7 cases, 10%) infections. Severe malaria cases were frequent among imported cases in Brazil outside of the Amazon area. The findings reinforce the idea that P. vivax infections in Brazil are not benign, regardless the endemicity of the area studied. Moreover, as the hospital is located in a privileged site, it could be used for future studies of malaria relapses and primaquine resistance mechanisms. Finally, based on the volume of cases treated and the secondary complications, referral malaria services are needed in the non-endemic areas of Brazil for a rapid and efficient and treatment.

Environmental Controls In The Water Use Patterns Of A Tropical Cloud Forest Tree Species, Drimys Brasiliensis (winteraceae).

Trees from tropical montane cloud forest (TMCF) display very dynamic patterns of water use. They are capable of downwards water transport towards the soil during leaf-wetting events, likely a consequence of foliar water uptake (FWU), as well as high rates of night-time transpiration (Enight) during drier nights. These two processes might represent important sources of water losses and gains to the plant, but little is known about the environmental factors controlling these water fluxes. We evaluated how contrasting atmospheric and soil water conditions control diurnal, nocturnal and seasonal dynamics of sap flow in Drimys brasiliensis (Miers), a common Neotropical cloud forest species. We monitored the seasonal variation of soil water content, micrometeorological conditions and sap flow of D. brasiliensis trees in the field during wet and dry seasons. We also conducted a greenhouse experiment exposing D. brasiliensis saplings under contrasting soil water conditions to deuterium-labelled fog water. We found that during the night D. brasiliensis possesses heightened stomatal sensitivity to soil drought and vapour pressure deficit, which reduces night-time water loss. Leaf-wetting events had a strong suppressive effect on tree transpiration (E). Foliar water uptake increased in magnitude with drier soil and during longer leaf-wetting events. The difference between diurnal and nocturnal stomatal behaviour in D. brasiliensis could be attributed to an optimization of carbon gain when leaves are dry, as well as minimization of nocturnal water loss. The leaf-wetting events on the other hand seem important to D. brasiliensis water balance, especially during soil droughts, both by suppressing tree transpiration (E) and as a small additional water supply through FWU. Our results suggest that decreases in leaf-wetting events in TMCF might increase D. brasiliensis water loss and decrease its water gains, which could compromise its ecophysiological performance and survival during dry periods.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

A dança no projeto "Arte, educação e cidadania" : um relato de experiencia

Universidade Estadual de Campinas . Faculdade de Educação Física

Da busca pela natureza aos ambientes artificiais : reflexões sobre a escalada esportiva

Universidade Estadual de Campinas . Faculdade de Educação Física