11 resultados para tumour-specific modulation frequencies

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to identify novel biomarkers for thyroid carcinoma diagnosis and prognosis. We have constructed a human single-chain variable fragment (scFv) antibody library that was selected against tumour thyroid cells using the BRASIL method (biopanning and rapid analysis of selective interactive ligands) and phage display technology. One highly reactive clone, scFv-C1, with specific binding to papillary thyroid tumour proteins was confirmed by ELISA, which was further tested against a tissue microarray that comprised of 229 thyroid tissues, including: 110 carcinomas (38 papillary thyroid carcinomas (PTCs), 42 follicular carcinomas, 30 follicular variants of PTC), 18 normal thyroid tissues, 49 nodular goitres (NG) and 52 follicular adenomas. The scFv-C1 was able to distinguish carcinomas from benign lesions (P=0.0001) and reacted preferentially against T1 and T2 tumour stages (P=0.0108). We have further identified an OTU domain-containing protein 1, DUBA-7 deubiquitinating enzyme as the scFv-binding antigen using two-dimensional polyacrylamide gel electrophoresis and mass spectrometry. The strategy of screening and identifying a cell-surface-binding antibody against thyroid tissues was highly effective and resulted in a useful biomarker that recognises malignancy among thyroid nodules and may help identify lower-risk cases that can benefit from less-aggressive management.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

There is an increasing rate of papillary thyroid carcinomas that may never progress to cause symptoms or death. Predicting outcome and determining tumour aggressiveness could help diminish the number of patients submitted to aggressive treatments. We aimed to evaluate whether markers of the immune system response and of tumour-associated inflammation could predict outcome of differentiated thyroid cancer (DTC) patients. Retrospective cohort study. We studied 399 consecutive patients, including 325 papillary and 74 follicular thyroid carcinomas. Immune cell markers were evaluated using immunohistochemistry, including tumour-associated macrophages (CD68) and subsets of tumour-infiltrating lymphocytes (TIL), such as CD3, CD4, CD8, CD16, CD20, CD45RO, GRANZYME B, CD69 and CD25. We also investigated the expression of cyclooxygenase 2 (COX2) in tumour cells and the presence of concurrent lymphocytic infiltration characterizing chronic thyroiditis. Concurrent lymphocytic infiltration characterizing chronic thyroiditis was observed in 29% of the cases. Among all the immunological parameters evaluated, only the enrichment of CD8+ lymphocytes (P = 0·001) and expression of COX2 (P =0·01) were associated with recurrence. A multivariate model analysis identified CD8+ TIL/COX2 as independent risk factor for recurrence. A multivariate analysis using Cox's proportional-hazards model adjusted for the presence of concurrent chronic thyroiditis demonstrated that the presence of concurrent chronic thyroiditis had no effect on prognostic prediction mediated by CD8+ TIL and COX2. In conclusion, we suggest the use of a relatively simple pathology tool to help select cases that may benefit of a more aggressive approach sparing the majority of patients from unnecessary procedures.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The SLC8A1 gene, which encodes the Na(+)/Ca(2+) exchanger, plays a key role in calcium homeostasis. Our previous gene expression oligoarray data revealed SLC8A1 underexpression in penile carcinoma (PeCa). The aim of this study was to investigate whether the dysregulation of SLC8A1 expression is associated with apoptosis and cell proliferation in PeCa, via modulation of calcium concentration. The underlying mechanisms of SLC8A1 underexpression were also explored, focusing on copy number alteration and microRNA. Transcript levels of SLC8A1 gene and miR-223 were evaluated by quantitative PCR, comparing PeCa samples with normal glans tissues. SLC8A1 copy number was evaluated by microarray-based comparative genomic hybridization (array-CGH). Caspase-3 and Ki-67 immunostaining, as well as calcium distribution by Laser Ablation Imaging Inductively Coupled Plasma Mass Spectrometry [LA(i)-ICP-MS], were investigated in both normal and tumor samples. Confirming our previous data, SLC8A1 underexpression was detected in PeCa samples (P=0.001) and was not associated with gene copy number loss. In contrast, overexpression of miR-223 (P=0.002) was inversely correlated with SLC8A1 (P=0.015, r=-0.426), its putative repressor. In addition, SLC8A1 underexpression was associated with decreased calcium distribution, high Ki-67 and low caspase-3 immunoexpression in PeCa when compared with normal tissues. Down-regulation of the SLC8A1 gene, most likely mediated by its regulator miR-223, can lead to reduced calcium levels in PeCa and, consequently, to suppression of apoptosis and increased tumor cell proliferation. These data suggest that the miR-223-NCX1-calcium-signaling axis may represent a potential therapeutic approach in PeCa.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Metastasizing pleomorphic adenoma (MPA) is a rare tumour, and its mechanism of metastasis still is unknown. To date, there has been no study on MPA genomics. We analysed primary and secondary MPAs with array comparative genomic hybridization to identify somatic copy number alterations and affected genes. Tumour DNA samples from primary (parotid salivary gland) and secondary (scalp skin) MPAs were subjected to array comparative genomic hybridization investigation, and the data were analysed with NEXUS COPY NUMBER DISCOVERY. The primary MPA showed copy number losses affecting 3p22.2p14.3 and 19p13.3p123, and a complex pattern of four different deletions at chromosome 6. The 3p deletion encompassed several genes: CTNNB1, SETD2, BAP1, and PBRM1, among others. The secondary MPA showed a genomic profile similar to that of the primary MPA, with acquisition of additional copy number changes affecting 9p24.3p13.1 (loss), 19q11q13.43 (gain), and 22q11.1q13.33 (gain). Our findings indicated a clonal origin of the secondary MPA, as both tumours shared a common profile of genomic copy number alterations. Furthermore, we were able to detect in the primary tumour a specific pattern of copy number alterations that could explain the metastasizing characteristic, whereas the secondary MPA showed a more unbalanced genome.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We tested the hypothesis that chronic pain development (pain chronification) and ongoing chronic pain (chronic pain) reduce the activity and induce plastic changes in an endogenous analgesia circuit, the ascending nociceptive control. An important mechanism mediating this form of endogenous analgesia, referred to as capsaicin-induced analgesia, is its dependence on nucleus accumbens μ-opioid receptor mechanisms. Therefore, we also investigated whether pain chronification and chronic pain alter the requirement for nucleus accumbens μ-opioid receptor mechanisms in capsaicin-induced analgesia. We used an animal model of pain chronification in which daily subcutaneous prostaglandin E2 (PGE2) injections into the rat's hind paw for 14 days, referred to as the induction period of persistent hyperalgesia, induce a long-lasting state of nociceptor sensitization referred to as the maintenance period of persistent hyperalgesia, that lasts for at least 30 days following the cessation of the PGE2 treatment. The nociceptor hypersensitivity was measured by the shortening of the time interval for the animal to respond to a mechanical stimulation of the hind paw. We found a significant reduction in the duration of capsaicin-induced analgesia during the induction and maintenance period of persistent mechanical hyperalgesia. Intra-accumbens injection of the μ-opioid receptor selective antagonist Cys(2),Tyr(3),Orn(5),Pen(7)amide (CTOP) 10 min before the subcutaneous injection of capsaicin into the rat's fore paw blocked capsaicin-induced analgesia. Taken together, these findings indicate that pain chronification and chronic pain reduce the duration of capsaicin-induced analgesia, without affecting its dependence on nucleus accumbens μ-opioid receptor mechanisms. The attenuation of endogenous analgesia during pain chronification and chronic pain suggests that endogenous pain circuits play an important role in the development and maintenance of chronic pain.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física