15 resultados para trichrome staining
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Paracoccidioidomycosis is a systemic mycosis that is endemic to certain countries in Latin America. This study aimed to describe the histological features of liver involvement in patients with paracoccidioidomycosis aged <16 years of age who were treated between 1980 and 2010, with a diagnosis that was confirmed by detection of the fungus by pathological examination. Liver tissue was obtained from one necropsy and 12 biopsies. Throughout 2007, biopsies were taken from patients with persistent jaundice or portal hypertension, after which biopsies became indicated due to elevated aminotransferase and low albumin levels. Using haematoxylin and eosin (H&E), Masson's trichrome and immunohistochemical (CK7 and CK19) staining, we noted degenerative alterations in bile duct cells and inflammatory injury to the bile ducts in 10 biopsies. Using immunohistochemistry for CK7 and CK19, we observed ductal proliferation in all 12 samples. Bile duct injuries by inflammatory cells might explain the predominant increase in canalicular enzymes; immunohistochemistry is more sensitive in demonstrating ductular reactions and might show changes that are not apparent on H&E staining.
Resumo:
Fibroblast cells grown in electrospun polymer scaffolds were stained with platinum blue, a heavy metal stain, and imaged using scanning electron microscopy. Good contrast on the cells was achieved compared with samples that were gold sputter coated. The cell morphology could be clearly observed, and the cells could be distinguished from the scaffold fibers. Here we optimized the required concentration of platinum blue for imaging cells grown in scaffolds and show that a higher concentration causes platinum aggregation. Overall, platinum blue is a useful stain for imaging cells because of its enhanced contrast using scanning electron microscopy (SEM). In the future it would be useful to investigate cell growth and morphology using three-dimensional imaging methods.
Resumo:
The aim of this study was to evaluate whether altered occlusion affects both the condylar cartilage thickness and the cytokine levels of the TMJs of rats. Thirty adult-male rats (n=30) were randomly assigned to three experimental conditions: a control group that underwent sham operations with unaltered occlusion; an FPDM group that underwent functional posterior displacement of the mandible that was induced by an incisor guiding appliance; and an iOVD group in which the increased occlusal vertical dimension was induced in the molars. The rats were subjected to the FPDM or iOVD model for 14 days and then killed. Both the right and left TMJs were removed and randomly assigned to examination with staining or immunoassay techniques. Toluidine blue staining was used to measure the thicknesses of the four layers of the articular cartilage (i.e., the fibrous, proliferating, mature, and hypertrophic layers). ELISA assays were used to assess the concentrations of the pro-inflammatory cytokines IL-1α, IL-1β, IL-6, and tumour necrosis factor (TNF-α). The measurements of the articular cartilage layers and cytokine concentrations were analyzed with ANOVA and Tukey's tests and Kruskal-Wallis and Dunn tests, respectively (α=5%). The thickness of articular cartilage in the FPDM group (0.3±0.03mm) was significantly greater than those of the control (0.2±0.01mm) and iOVD (0.25±0.03mm) groups. No significant difference was observed between the control and iOVD groups. The four articular cartilage layers were thicker in the FPDM group than in the control and iOVD groups, and the latter two groups did not differ one from each other. Both the FPDM and iOVD groups exhibited higher cytokine levels than did the control (p<0.05) group. Compared to the FPDM group, the iOVD group exhibited significantly higher levels of IL-1β and TNF-α. Both models induced inflammation in the TMJ and caused significant structural changes in the TMJ and surrounding tissues.
Resumo:
We assessed associations between steroid receptors including: estrogen-alpha, estrogen-beta, androgen receptor, progesterone receptor, the HER2 status and triple-negative epithelial ovarian cancer (ERα-/PR-/HER2-; TNEOC) status and survival in women with epithelial ovarian cancer. The study included 152 women with primary epithelial ovarian cancer. The status of steroid receptor and HER2 was determined by immunohistochemistry. Disease-free and overall survival were calculated and compared with steroid receptor and HER2 status as well as clinicopathological features using the Cox Proportional Hazards model. A mean follow-up period of 43.6 months (interquartile range=41.4 months) was achieved where 44% of patients had serous tumor, followed by mucinous (23%), endometrioid (9%), mixed (9%), undifferentiated (8.5%) and clear cell tumors (5.3%). ER-alpha staining was associated with grade II-III tumors. Progesterone receptor staining was positively associated with a Body Mass Index≥25. Androgen receptor positivity was higher in serous tumors. In stand-alone analysis of receptor contribution to survival, estrogen-alpha positivity was associated with greater disease-free survival. However, there was no significant association between steroid receptor expression, HER2 status, or TNEOC status, and overall survival. Although estrogen-alpha, androgen receptor, progesterone receptor and the HER2 status were associated with key clinical features of the women and pathological characteristics of the tumors, these associations were not implicated in survival. Interestingly, women with TNEOC seem to fare the same way as their counterparts with non-TNEOC.
Resumo:
Herein we describe the synthesis of a focused library of compounds based on the structure of goniothalamin (1) and the evaluation of the potential antitumor activity of the compounds. N-Acylation of aza-goniothalamin (2) restored the in vitro antiproliferative activity of this family of compounds. 1-(E)-But-2-enoyl-6-styryl-5,6-dihydropyridin-2(1H)-one (18) displayed enhanced antiproliferative activity. Both goniothalamin (1) and derivative 18 led to reactive oxygen species generation in PC-3 cells, which was probably a signal for caspase-dependent apoptosis. Treatment with derivative 18 promoted Annexin V/7-aminoactinomycin D double staining, which indicated apoptosis, and also led to G2 /M cell-cycle arrest. In vivo studies in Ehrlich ascitic and solid tumor models confirmed the antitumor activity of goniothalamin (1), without signs of toxicity. However, derivative 18 exhibited an unexpectedly lower in vivo antitumor activity, despite the treatments being administered at the same site of inoculation. Contrary to its in vitro profile, aza-goniothalamin (2) inhibited Ehrlich tumor growth, both on the ascitic and solid forms. Our findings highlight the importance of in vivo studies in the search for new candidates for cancer treatment.
Resumo:
G-CSF has been shown to decrease inflammatory processes and to act positively on the process of peripheral nerve regeneration during the course of muscular dystrophy. The aims of this study were to investigate the effects of treatment of G-CSF during sciatic nerve regeneration and histological analysis in the soleus muscle in MDX mice. Six-week-old male MDX mice underwent left sciatic nerve crush and were G-CSF treated at 7 days prior to and 21 days after crush. Ten and twenty-one days after surgery, the mice were euthanized, and the sciatic nerves were processed for immunohistochemistry (anti-p75(NTR) and anti-neurofilament) and transmission electron microscopy. The soleus muscles were dissected out and processed for H&E staining and subsequent morphologic analysis. Motor function analyses were performed at 7 days prior to and 21 days after sciatic crush using the CatWalk system and the sciatic nerve index. Both groups treated with G-CSF showed increased p75(NTR) and neurofilament expression after sciatic crush. G-CSF treatment decreased the number of degenerated and regenerated muscle fibers, thereby increasing the number of normal muscle fibers. The reduction in p75(NTR) and neurofilament indicates a decreased regenerative capacity in MDX mice following a lesion to a peripheral nerve. The reduction in motor function in the crushed group compared with the control groups may reflect the cycles of muscle degeneration/regeneration that occur postnatally. Thus, G-CSF treatment increases motor function in MDX mice. Nevertheless, the decrease in baseline motor function in these mice is not reversed completely by G-CSF.
Resumo:
Mucositis induced by anti-neoplastic drugs is an important, dose-limiting and costly side-effect of cancer therapy. To evaluate the effect of the topical application of S-nitrosoglutathione (GSNO), a nitric oxide donor, on 5-fluorouracil (5-FU)-induced oral mucositis in hamsters. Oral mucositis was induced in male hamsters by two intraperitoneal administrations of 5-FU on the first and second days of the experiment (60 and 40 mg/kg, respectively) followed by mechanical trauma on the fourth day. Animals received saline, HPMC or HPMC/GSNO (0.1, 0.5 or 2.0 mM) 1 h prior to the 5-FU injection and twice a day for 10 or 14 days. Samples of cheek pouches were harvested for: histopathological analysis, TNF-α and IL-1β levels, immunohistochemical staining for iNOS, TNF-α, IL-1β, Ki67 and TGF-β RII and a TUNEL assay. The presence and levels of 39 bacterial taxa were analyzed using the Checkerboard DNA-DNA hybridization method. The profiles of NO released from the HPMC/GSNO formulations were characterized using chemiluminescence. The HPMC/GSNO formulations were found to provide sustained release of NO for more than 4 h at concentration-dependent rates of 14 to 80 nmol/mL/h. Treatment with HPMC/GSNO (0.5 mM) significantly reduced mucosal damage, inflammatory alterations and cell death associated with 5-FU-induced oral mucositis on day 14 but not on day 10. HPMC/GSNO administration also reversed the inhibitory effect of 5-FU on cell proliferation on day 14. In addition, we observed that the chemotherapy significantly increased the levels and/or prevalence of several bacterial species. Topical HPMC/GSNO accelerates mucosal recovery, reduces inflammatory parameters, speeds up re-epithelization and decreases levels of periodontopathic species in mucosal ulcers.
Resumo:
Aware of the diffusion capacity of bleaching in the dental tissues, many orthodontists are subjecting their patients to dental bleaching during orthodontic treatment for esthetic purposes or to anticipate the exchange of esthetic restorations after the orthodontic treatment. For this purpose specific products have been developed in pre-loaded whitening trays designed to fit over and around brackets and wires, with clinical efficacy proven. The objective of this study was to evaluate, through spectrophotometric reflectance, the effectiveness of dental bleaching under orthodontic bracket. Thirty-two bovine incisors crown blocks of 8 mm x 8 mm height lengths were used. Staining of tooth blocks with black tea was performed for six days. They were distributed randomly into 4 groups (1-home bleaching with bracket, 2- home bleaching without bracket, 3- office bleaching with bracket, 4 office bleaching without bracket). The color evaluation was performed (CIE L * a * b *) using color reflectance spectrophotometer. Metal brackets were bonded in groups 1 and 3. The groups 1 and 2 samples were subjected to the carbamide peroxide at 15%, 4 hours daily for 21 days. Groups 3 and 4 were subjected to 3 in-office bleaching treatment sessions, hydrogen peroxide 38%. After removal of the brackets, the second color evaluation was performed in tooth block, difference between the area under the bracket and around it, and after 7 days to verified color stability. Data analysis was performed using the paired t-test and two-way variance analysis and Tukey's. The home bleaching technique proved to be more effective compared to the office bleaching. There was a significant difference between the margin and center color values of the specimens that were subjected to bracket bonding. The bracket bond presence affected the effectiveness of both the home and office bleaching treatments. Key words:Tooth bleaching, spectrophotometry, orthodontics.
Resumo:
Oxidative stress and inflammatory processes strongly contribute to pathogenesis in Duchenne muscular dystrophy (DMD). Based on evidence that excess iron may increase oxidative stress and contribute to the inflammatory response, we investigated whether deferoxamine (DFX), a potent iron chelating agent, reduces oxidative stress and inflammation in the diaphragm (DIA) muscle of mdx mice (an experimental model of DMD). Fourteen-day-old mdx mice received daily intraperitoneal injections of DFX at a dose of 150 mg/kg body weight, diluted in saline, for 14 days. C57BL/10 and control mdx mice received daily intraperitoneal injections of saline only, for 14 days. Grip strength was evaluated as a functional measure, and blood samples were collected for biochemical assessment of muscle fiber degeneration. In addition, the DIA muscle was removed and processed for histopathology and Western blotting analysis. In mdx mice, DFX reduced muscle damage and loss of muscle strength. DFX treatment also resulted in a significant reduction of dystrophic inflammatory processes, as indicated by decreases in the inflammatory area and in NF-κB levels. DFX significantly decreased oxidative damage, as shown by lower levels of 4-hydroxynonenal and a reduction in dihydroethidium staining in the DIA muscle of mdx mice. The results of the present study suggest that DFX may be useful in therapeutic strategies to ameliorate dystrophic muscle pathology, possibly via mechanisms involving oxidative and inflammatory pathways.
Resumo:
Dystrophin-deficient muscles have repeated cycles of necrosis and regeneration, being susceptible to injury induced by muscle contractions. Some studies have demonstrated that tendons are also affected in mdx mice, based especially on the changes in biomechanical properties arising from the respective linked muscles. However, most studies have focused only on alterations in the myotendinous junction. Thus, the purpose of this work was to study biochemical and morphological alterations in the Achilles tendons of 60-day-old mdx mice. Hydroxyproline quantification, showed higher collagen concentration in the mdx mice as compared with the control. No difference between the tendons of both groups was found in the noncollagenous proteins dosage, and in the amount of collagen type III detected in the western blotting analysis. The zymography for gelatinases detection showed higher amounts of metaloproteinase-2 (active isoform) and of metalloproteinase-9 (latent isoform) in the mdx mice. Measurements of birefringence, using polarization microscopy, showed higher molecular organization of the collagen fibers in the tendons of mdx mice in comparison to the control group, with presence of larger areas of crimp. Ponceau SS-stained tendon sections showed stronger staining of the extracellular matrix in the mdx groups. Toluidine blue-stained sections showed more intense basophilia in tendons of the control group. In morphometry, a higher number of inflammatory cells was detected in the epitendon of mdx group. In conclusion, the Achilles tendon of 60-day-old mdx mice presents higher collagen concentration and organization of the collagen fibers, enhanced metalloproteinase-2 activity, as well as prominent presence of inflammatory cells and lesser proteoglycans.
Resumo:
In this study, we aimed to evaluate the effects of exenatide (EXE) treatment on exocrine pancreas of nonhuman primates. To this end, 52 baboons (Papio hamadryas) underwent partial pancreatectomy, followed by continuous infusion of EXE or saline (SAL) for 14 weeks. Histological analysis, immunohistochemistry, Computer Assisted Stereology Toolbox morphometry, and immunofluorescence staining were performed at baseline and after treatment. The EXE treatment did not induce pancreatitis, parenchymal or periductal inflammatory cell accumulation, ductal hyperplasia, or dysplastic lesions/pancreatic intraepithelial neoplasia. At study end, Ki-67-positive (proliferating) acinar cell number did not change, compared with baseline, in either group. Ki-67-positive ductal cells increased after EXE treatment (P = 0.04). However, the change in Ki-67-positive ductal cell number did not differ significantly between the EXE and SAL groups (P = 0.13). M-30-positive (apoptotic) acinar and ductal cell number did not change after SAL or EXE treatment. No changes in ductal density and volume were observed after EXE or SAL. Interestingly, by triple-immunofluorescence staining, we detected c-kit (a marker of cell transdifferentiation) positive ductal cells co-expressing insulin in ducts only in the EXE group at study end, suggesting that EXE may promote the differentiation of ductal cells toward a β-cell phenotype. In conclusion, 14 weeks of EXE treatment did not exert any negative effect on exocrine pancreas, by inducing either pancreatic inflammation or hyperplasia/dysplasia in nonhuman primates.
Resumo:
To evaluate p16(INK) (4a) immunoexpression in CIN1 lesions looking for differences between cases that progress to CIN2/3 maintain CIN1 diagnosis, or spontaneously regress. Seventy-four CIN1 biopsies were studied. In the follow-up, a second biopsy was performed and 28.7% showed no lesion (regression), 37.9% maintained CIN1, and 33.4% progressed to CIN2/3. Immunostaining for p16(INK) (4a) was performed in the first biopsy and it was considered positive when there was strong and diffuse staining of the basal and parabasal layers. Pearson's chi-square was used to compare the groups (p ≤ 0.05). The age of the patients was similar. There was no significant difference in p16(INK) (4a) immunoexpression in the groups, however, statistical analyses showed a significant association when only the progression and regression groups were compared (p = 0.042). Considering p16(INK) (4a) positivity and the progression to CIN2/3, the sensitivity, specificity, positive, and negative predictive values in our cohort were 45%, 75%, 47%, and 94%, respectively. We emphasize that CIN1 with p16(INK) (4a) staining was associated with lesion progression, but the sensitivity was not high. However, the negative predictive value was more reliable (94%) and p16(INK) (4a) may represent a useful biomarker that can identify CIN1 lesions that need particular attention, complementing morphology.
Resumo:
The aim of this study was to compare two methods of surface roughness analysis, perfilometry and spectrophotometry, applied to the surface of ionomeric materials (Chelon Fil, Vitremer and Dyract), submitted to different surface finishing treatments. For the perfilometric analysis, sixty specimens of each material were made and randomly separated into three experimental groups. The average surface roughness (Ra, mm) was measured on each specimen by a surface perfilometer (Mitutoyo Surftest 211). The spectrophotometric analysis consisted in quantifying the dye impregnated in the samples. The dyes used were 0.5% fuchsin and 0.5% erythrosin. Data were submitted to variance analysis (ANOVA) and t-Student test at a 0.05 significance level. There was no linear correlation between average roughness and superficial deposition of dye. Perfilometric analysis revealed that 12- and 30-bladed carbide burs caused the roughest surface of Chelon Fil, followed by Sof-Lex discs and mylar band. There were no significant differences between the specimens submitted to finishing and polishing with Sof-Lex discs and the control group (mylar band) for Vitremer, nevertheless, the highest Ra values were obtained when 12- and 30-bladed burs were used. For Dyract, there was no significant difference between the three treatments. The mean values of superficial deposition of dye for Chelon Fil, Vitremer and Dyract were: 1.7261, 1.4759, 1.3318, respectively. There were no significant differences between the restorative materials when different finishing and polishing systems were used.
Resumo:
The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.