71 resultados para sujeito agente
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
We studied 271 children under age of 15 with diagnosis of acute bacterial meningencephalitis treated at Medical School in Ribeirão Preto, University of São Paulo, between 1980 and 1990. The patients were divided in two groups: 1) those who had not received previous antibiotics treatment (NTP), with 153 cases; and 2), those who had received previous antibiotics treatment (PT), with 118 cases. The etiological agent was more frequently identified in NPT group, while ventriculitis was more frequent in PT group. Mortality rate accounted for 19,5% of all cases, and 29.7% of children under 12 months of age. Acute meningitis caused by Streptococcus pneumoniae was frequently followed by increased mortality. Convulsive disorders and hemiparesis predominante among children under 12 months of age. On the neurosurgical point of view, ventriculitis, subdural hygroma, hydrocephalus, subdural empyema and brain abscess were identified and treated
Resumo:
The individual affective-cognitive evaluations are important factors that control the way he feels the disease impact in his life. Then, the perception of seizure control is a more important factor to evaluate Quality of Life (QoL) than the illness characteristics, such as the severity, type, sickening period and seizure frequency. This study searched for the relationship among the subjective variables (perception of seizure control) and the illness characteristics to evaluate QoL. The sample consisted of 60 individuals with chronic epilepsy, aging 18 to 70 (M=37.05; SD=11.25), chosen at randon from the ambulatory of epilepsy - HC/UNICAMP, by the Questionnaire 65. The illness characteristics were not significant, except the seizures frequency, when associated to the impairment in QoL among controlled seizures and seizures with frequency higher than 10 per month (p=0.021). The perception of control was significantly associated to QoL (p=0.005).
Resumo:
Concept formation depends on language and thought, that promote the integration of information coming from the senses. It is postulated that changes in the person, the objects and events to be known suggest flexible models of concept teaching. It is assumed that the same considerations apply to teaching concepts to blind pupils. Specificities of this process are discussed, including the role of touch as resource, although not as a direct substitute to vision, and the notion of representation as a basis for the elaboration of pedagogical resources for the blind student.
Resumo:
The article presents studies of a current investigation among 75 adolescents from 12 to 15 years old, students of private schools of Campinas city, that have as main objective to notice a possible correspondence among the moral judgments and the representation that individuals have about themselves. From a questionnaire, the studies bring out the representations of these individuals and answer a questioning if they would have an ethical character or not and if these individuals would correspond to their moral judgments. The results point out to a correspondence among those whose self representations are characterized by more evolved ethical contents and judgments related to sensitivity and to the characters feelings involved in the situations described. Such studies validate the intention of this article to discuss the correspondences between ethics (how the individual sees himself/herself) and moral (how he/she judges the situations moral).
Resumo:
This paper discusses theoretical results of the research project Linguistic Identity and Identification: A Study of Functions of Second Language in Enunciating Subject Constitution. Non-cognitive factors that have a crucial incidence in the degree of success and ways of accomplishment of second language acquisition process are focused. A transdisciplinary perspective is adopted, mobilising categories from Discourse Analysis and Psychoanalysis. The most relevant ones are: discursive formation, intradiscourse, interdiscourse, forgetting n° 1, forgetting n° 2 (Pêcheux, 1982), identity, identification (Freud, 1966; Lacan, 1977; Nasio, 1995). Revuz s views (1991) are discussed. Her main claim is that during the process of learning a foreign language, the foundations of psychical structure, and consequently first language, are required. After examining how nomination and predication processes work in first and second languages, components of identity and identification processes are focused on, in an attempt to show how second language acquisition strategies depend on them. It is stated that methodological affairs of language teaching, learner s explicit motivation and the like are subordinated to the comprehension of deeper non-cognitive factors that determine the accomplishment of the second language acquisition process. It is also pointed out that those factors are to be approached, questioning the bipolar biological-social conception of subjectivity in the study of language acquisition and use and including in the analysis symbolic and significant dimensions of the discourse constitution process.
Resumo:
The main purpose of this paper is to question the relationship between theory and practice or basic and applied research in the domain of Applied Linguistics and classroom discourse. In order to achieve our aim, some theoretical texts, some recorded and transcribed classes as well as some teachers and students opinions about reading and writing were analysed. Results have shown that 1) practice is not the direct application of theoretical data: the relationship between them is not as simple as some applied linguists seem to believe because of the action of the unconscious in the constitution of subjectivity; 2) the conceptualization of the theoretical issues takes place in a confused and disorderly manner mixed up with personal experiences and previous knowledge (practice). We intend to question the fact that practice comes as secondary to theory.
Resumo:
This article considers a procedure for data collection called autoscopy. Autoscopy entails the video recording of a practice with the purpose of allowing analysis and self-evaluation by one of the protagonists of that practice. The objective of the video recording is that of apprehending the actions of the agent (or agents), the scenario, and the plot that make up a situation. The recorded material is subjected to sessions of analysis after the action that aim at the understanding of the reflective process of the agent (or agents) through their verbalizations during the analysis of video recorded scenes. The present text introduces a theoretical basis for the procedure of autoscopy, deals with advantages and limitations of its use, as well as with aspects that deserve attention and, finally, describes the authors' experiences in two studies in which the procedure was employed. Starting from these two experiences, differences and similarities are pointed out between the studies, especially regarding the participants, object, and the time distribution of the video recordings. The authors draw considerations about the formative-reflective potential of the procedure, both for research situations and for the learning and training of various professionals, considering it to be an excellent educational instrument. It is, however, vital to keep in mind the need to recognize and return to the teacher, as an autoscopic participant, his condition as subject of his own profession, thereby promoting, besides the self-evaluation, also the autonomy of his thinking and doing.
Resumo:
In this article, it is discussed the role of interaction in the process of teaching and learning Portuguese of deaf students at an inclusive school. In the context where the research took place, the hearing teacher does not understand sign language, and there are, in her classroom, hearing students and four deaf students, being three of them sign language users. As the communication between the hearing teacher and the deaf students occurred in different codes - Portuguese and Brazilian sign language - and having a social-interactional approach of language (MOITA LOPES, 1986; FREIRE, 1999), we observed if the interaction among the subjects enabled the deaf students to understand what was being taught. The results showed that the fact of having four deaf students in the same classroom allowed them to work in a cooperative way. Besides, the sign language became more visible in this institution. On the other hand, the interaction between the teacher and her deaf students revealed to be of little significance to the learning process of this small group.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
Central nervous system involvement in Candida septicaemia is rare and not more than four cases have been published in Brazil. Five new cases of systemic candidiasis with cerebral lesions are reported. All patients (four adults and a child) had serious underlying diseases and were submitted to heavy long-term antibiotic therapy with multiple drugs. Seizures in one case and neck stiffness in another were the only neurologic signs that could be attributed to candidiasis. In no case were the lesions severe enough to be considered an immediate cause of death. In three patients, no macroscopic changes were evident in the brain, but microabscesses and granulomata were observed on microscopical examination; another patient had two gross areas with necrotic and haemorrhagic appearance in the cerebral hemispheres; the child had only two microscopic granulomata. The aetiological agent was demonstrated by Grocott's methenamine silver technique in all cases. Involvement of organs other than the central nervous system could be demonstrated in three autopsies. Discussion is confined mainly to such aspects as the contributory factors in the pathogenesis of systemic candidiasis as well as the marked rise in the incidence of this condition in the past few decades. It is suggested that the frequence of monilial septicaemia in Brazil may be far more serious than apparent from the scarcity of reported cases.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física