Platinum Blue Staining Of Cells Grown In Electrospun Scaffolds.

Fibroblast cells grown in electrospun polymer scaffolds were stained with platinum blue, a heavy metal stain, and imaged using scanning electron microscopy. Good contrast on the cells was achieved compared with samples that were gold sputter coated. The cell morphology could be clearly observed, and the cells could be distinguished from the scaffold fibers. Here we optimized the required concentration of platinum blue for imaging cells grown in scaffolds and show that a higher concentration causes platinum aggregation. Overall, platinum blue is a useful stain for imaging cells because of its enhanced contrast using scanning electron microscopy (SEM). In the future it would be useful to investigate cell growth and morphology using three-dimensional imaging methods.

Fracture Of Distal Humerus: Mipo Technique With Visualization Of The Radial Nerve.

To evaluate the outcomes in patients treated for humerus distal third fractures with MIPO technique and visualization of the radial nerve by an accessory approach, in those without radial palsy before surgery. The patients were treated with MIPO technique. The visualization and isolation of the radial nerve was done by an approach between the brachialis and the brachiorradialis, with an oblique incision, in the lateral side of the arm. MEPS was used to evaluate the elbow function. Seven patients were evaluated with a mean age of 29.8 years old. The average follow up was 29.85 months. The radial neuropraxis after surgery occurred in three patients. The sensorial recovery occurred after 3.16 months on average and also of the motor function, after 5.33 months on average, in all patients. We achieved fracture consolidation in all patients (M=4.22 months). The averages for flexion-extension and prono-supination were 112.85° and 145°, respectively. The MEPS average score was 86.42. There was no case of infection. This approach allowed excluding a radial nerve interposition on site of the fracture and/or under the plate, showing a high level of consolidation of the fracture and a good evolution of the range of movement of the elbow. Level of Evidence IV, Case Series.

Spectrophotometric Evaluation Of Dental Bleaching Under Orthodontic Bracket In Enamel And Dentin.

Aware of the diffusion capacity of bleaching in the dental tissues, many orthodontists are subjecting their patients to dental bleaching during orthodontic treatment for esthetic purposes or to anticipate the exchange of esthetic restorations after the orthodontic treatment. For this purpose specific products have been developed in pre-loaded whitening trays designed to fit over and around brackets and wires, with clinical efficacy proven. The objective of this study was to evaluate, through spectrophotometric reflectance, the effectiveness of dental bleaching under orthodontic bracket. Thirty-two bovine incisors crown blocks of 8 mm x 8 mm height lengths were used. Staining of tooth blocks with black tea was performed for six days. They were distributed randomly into 4 groups (1-home bleaching with bracket, 2- home bleaching without bracket, 3- office bleaching with bracket, 4 office bleaching without bracket). The color evaluation was performed (CIE L * a * b *) using color reflectance spectrophotometer. Metal brackets were bonded in groups 1 and 3. The groups 1 and 2 samples were subjected to the carbamide peroxide at 15%, 4 hours daily for 21 days. Groups 3 and 4 were subjected to 3 in-office bleaching treatment sessions, hydrogen peroxide 38%. After removal of the brackets, the second color evaluation was performed in tooth block, difference between the area under the bracket and around it, and after 7 days to verified color stability. Data analysis was performed using the paired t-test and two-way variance analysis and Tukey's. The home bleaching technique proved to be more effective compared to the office bleaching. There was a significant difference between the margin and center color values of the specimens that were subjected to bracket bonding. The bracket bond presence affected the effectiveness of both the home and office bleaching treatments. Key words:Tooth bleaching, spectrophotometry, orthodontics.

In Vitro Effects Of Hydrogen Peroxide Combined With Different Activators For The In-office Bleaching Technique On Enamel.

Abstract Objective. The aim of this study was to evaluate the alteration of human enamel bleached with high concentrations of hydrogen peroxide associated with different activators. Materials and methods. Fifty enamel/dentin blocks (4 × 4 mm) were obtained from human third molars and randomized divided according to the bleaching procedure (n = 10): G1 = 35% hydrogen peroxide (HP - Whiteness HP Maxx); G2 = HP + Halogen lamp (HL); G3 = HP + 7% sodium bicarbonate (SB); G4 = HP + 20% sodium hydroxide (SH); and G5 = 38% hydrogen peroxide (OXB - Opalescence Xtra Boost). The bleaching treatments were performed in three sessions with a 7-day interval between them. The enamel content, before (baseline) and after bleaching, was determined using an FT-Raman spectrometer and was based on the concentration of phosphate, carbonate, and organic matrix. Statistical analysis was performed using two-way ANOVA for repeated measures and Tukey's test. Results. The results showed no significant differences between time of analysis (p = 0.5175) for most treatments and peak areas analyzed; and among bleaching treatments (p = 0.4184). The comparisons during and after bleaching revealed a significant difference in the HP group for the peak areas of carbonate and organic matrix, and for the organic matrix in OXB and HP+SH groups. Tukey's analysis determined that the difference, peak areas, and the interaction among treatment, time and peak was statistically significant (p < 0.05). Conclusion. The association of activators with hydrogen peroxide was effective in the alteration of enamel, mainly with regards to the organic matrix.

Preservation Of The External Jugular Vein In Bilateral Radical Neck Dissections: Technique In Two Cases And Review Of The Literature.

Context. The possibility of cephalic venous hypertension with the resultant facial edema and elevated cerebrospinal fluid pressure continues to challenge head and neck surgeons who perform bilateral radical neck dissections during simultaneous or staged procedures. Case Report. The staged procedure in patients who require bilateral neck dissections allows collateral venous drainage to develop, mainly through the internal and external vertebral plexuses, thereby minimizing the risks of deleterious consequences. Nevertheless, this procedure has disadvantages, such as a delay in definitive therapy, the need for a second hospitalization and anesthesia, and the risk of cutting lymphatic vessels and spreading viable cancer cells. In this paper, we discuss the rationale and feasibility of preserving the external jugular vein. Considering the limited number of similar reports in the literature, two cases in which this procedure was accomplished are described. The relevant anatomy and technique are reviewed and the patients' outcomes are discussed. Conclusion. Preservation of the EJV during bilateral neck dissections is technically feasible, fast, and safe, with clinically and radiologically demonstrated patency.

Biochemical And Morphological Alterations In The Achilles Tendon Of Mdx Mice.

Dystrophin-deficient muscles have repeated cycles of necrosis and regeneration, being susceptible to injury induced by muscle contractions. Some studies have demonstrated that tendons are also affected in mdx mice, based especially on the changes in biomechanical properties arising from the respective linked muscles. However, most studies have focused only on alterations in the myotendinous junction. Thus, the purpose of this work was to study biochemical and morphological alterations in the Achilles tendons of 60-day-old mdx mice. Hydroxyproline quantification, showed higher collagen concentration in the mdx mice as compared with the control. No difference between the tendons of both groups was found in the noncollagenous proteins dosage, and in the amount of collagen type III detected in the western blotting analysis. The zymography for gelatinases detection showed higher amounts of metaloproteinase-2 (active isoform) and of metalloproteinase-9 (latent isoform) in the mdx mice. Measurements of birefringence, using polarization microscopy, showed higher molecular organization of the collagen fibers in the tendons of mdx mice in comparison to the control group, with presence of larger areas of crimp. Ponceau SS-stained tendon sections showed stronger staining of the extracellular matrix in the mdx groups. Toluidine blue-stained sections showed more intense basophilia in tendons of the control group. In morphometry, a higher number of inflammatory cells was detected in the epitendon of mdx group. In conclusion, the Achilles tendon of 60-day-old mdx mice presents higher collagen concentration and organization of the collagen fibers, enhanced metalloproteinase-2 activity, as well as prominent presence of inflammatory cells and lesser proteoglycans.

High Prevalence Of Insulin Resistance Assessed By The Glucose Clamp Technique In Hormonal And Non-hormonal Contraceptive Users.

Objective To assess the prevalence of insulin resistance (IR) and associated factors in contraceptive users. Methods A total of 47 women 18 to 40 years of age with a body mass index (kg/m(2)) < 30, fasting glucose levels < 100 mg/dl and 2-hour glucose level < 140 mg/dl after a 75-g oral glucose load were submitted to a hyperinsulinemic-euglycemic clamp. The women were distributed in tertiles regarding M-values. The analysed variables were use of combined hormonal/non-hormonal contraception, duration of use, body composition, lipid profile, glucose levels and blood pressure. Results IR was detected in 19% of the participants. The women with low M-values presented significantly higher body fat mass, waist-to-hip ratio, fasting insulin, HOMA-IR and were nulligravida, showed > 1 year of contraceptive use and higher triglyceride levels. IR was more frequent among combined oral contraceptive users, however no association was observed after regression analysis. Conclusions The prevalence of IR was high among healthy women attending a family planning clinic independent of the contraceptive method used with possible long-term negative consequences regarding their metabolic and cardiovascular health. Although an association between hormonal contraception and IR could not be found this needs further research. Family planning professionals should be proactive counselling healthy women about the importance of healthy habits.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.