Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Obesogenic Environment By Excess Of Dietary Fats In Different Phases Of Development Reduces Spermatic Efficiency Of Wistar Rats At Adulthood: Correlations With Metabolic Status.

This study compares the impact of obesogenic environment (OE) in six different periods of development on sperm parameters and the testicular structure of adult rats and their correlations with sex steroid and metabolic scenario. Wistar rats were exposed to OE during gestation (O1), during gestation/lactation (O2), from weaning to adulthood (O3), from lactation to adulthood (O4), from gestation to sexual maturity (O5), and after sexual maturation (O6). OE was induced by a 20% fat diet, and control groups were fed a balanced diet (4% fat). Serum leptin levels and adiposity index indicate that all groups were obese, except for O1. Three progressive levels of impaired metabolic status were observed: O1 presented insulin resistance, O2 were insulin resistant and obese, and groups O3, O4, and O5 were insulin resistant, obese, and diabetic. These three levels of metabolic damage were proportional to the increase of leptin and decreased circulating testosterone. The impairment in the daily sperm production (DSP) paralleled these three levels of metabolic and hormonal damage being marginal in O1, increasing in O2, and being higher in groups O3, O4, O5, and O6. None of the OE periods affected the sperm transit time in the epididymis, and the lower sperm reserves were caused mainly by impaired DSP. In conclusion, OE during sexual maturation markedly reduces the DSP at adulthood in the rat. A severe reduction in the DSP also occurs in OE exposure during gestation/lactation but not in gestation, indicating that breast-feeding is a critical period for spermatogenic impairment under obesogenic conditions.

Formação das substâncias de reserva durante o desenvolvimento de sementes de urucum (Bixa orellana L. - Bixaceae)

Annatto seeds do not germinate during early stages of their development because of insufficient reserve substances. In situ analysis showed that the principal reserves are proteins and starch, deposited in endosperm cells. During the early stages of development, the starch grains were elliptic, because amylose was the minor component. During development, these grains became more spherical due to an increase in amylose relative to amylopectin. Endosperm cells do not contain protein bodies, but they accumulate proteins dispersed in the cytoplasm. At the final stage of development the proteins became compacted due to the dehydration of the seeds wich is part of the global process of orthodox seeds maturation. Natural fluorescence revealed aromatic amino acids, principally tryptophan and tyrosine in the proteins. The seeds reached their maximum dry weight after moisture contents had declined to around 60%. At this point the seeds presented maximum germination capacity.

Controle autonomico da frequencia cardiaca de adolescentes em treinamento

Universidade Estadual de Campinas . Faculdade de Educação Física