10 resultados para sprains and strains

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

80.00% 80.00%

Publicador:

Resumo:

Schistosomiasis is a common tropical disease caused by Schistosoma species Schistosomiasis' pathogenesis is known to vary according to the worms' strain. Moreover, high parasitical virulence is directly related to eggs release and granulomatous inflammation in the host's organs. This virulence might be influenced by different classes of molecules, such as lipids. Therefore, better understanding of the metabolic profile of these organisms is necessary, especially for an increased potential of unraveling strain virulence mechanisms and resistance to existing treatments. In this report, direct-infusion electrospray high-resolution mass spectrometry (ESI(+)-HRMS) along with the lipidomic platform were employed to rapidly characterize and differentiate two Brazilian S. mansoni strains (BH and SE) in three stages of their life cycle: eggs, miracidia and cercariae, with samples from experimental animals (Swiss/SPF mice). Furthermore, urine samples of the infected and uninfected mice were analyzed to assess the possibility of direct diagnosis. All samples were differentiated using multivariate data analysis, PCA, which helped electing markers from distinct lipid classes; phospholipids, diacylglycerols and triacylglycerols, for example, clearly presented different intensities in some stages and strains, as well as in urine samples. This indicates that biochemical characterization of S. mansoni may help narrowing-down the investigation of new therapeutic targets according to strain composition and aggressiveness of disease. Interestingly, lipid profile of infected mice urine varies when compared to control samples, indicating that direct diagnosis of schistosomiasis from urine may be feasible.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Collection of triatomines in domestic, peridomestic and sylvatic environments in states of Bahia and Rio Grande do Sul, Northeastern and Southern Brazil respectively, and isolation of Trypanosoma cruzi strains. First, the captured triatomines were identified using insect identification keys, then their intestinal content was examined by abdominal compression, and the samples containing trypanosomatid forms were inoculated in LIT medium and Swiss mice. Six triatomine species were collected in cities in Bahia, namely Panstrongylus geniculatus (01), Triatoma melanocephala (11), T. lenti (94), T. pseudomaculata (02), T. sherlocki (26) and T. sordida (460), and two in cities in Rio Grande do Sul, namely T. circummaculata (11) and T. rubrovaria (115). Out of the specimens examined, T. cruzi was isolated from 28 triatomine divided into four different species: T. melanocephala (one), T. lenti (one), T. rubrovaria (16) and T. sordida (10). Their index of natural infection by T. cruzi was 6.4%. The isolation of T. cruzi strains from triatomines found in domestic and peridomestic areas shows the potential risk of transmission of Chagas disease in the studied cities. The maintenance of those T. cruzi strains in laboratory is intended to promote studies that facilitate the understanding of the parasite-vector-host relationship.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Snakebite is a neglected disease and serious health problem in Brazil, with most bites being caused by snakes of the genus Bothrops. Although serum therapy is the primary treatment for systemic envenomation, it is generally ineffective in neutralizing the local effects of these venoms. In this work, we examined the ability of 7,8,3'-trihydroxy-4'-methoxyisoflavone (TM), an isoflavone from Dipteryx alata, to neutralize the neurotoxicity (in mouse phrenic nerve-diaphragm preparations) and myotoxicity (assessed by light microscopy) of Bothrops jararacussu snake venom in vitro. The toxicity of TM was assessed using the Salmonella microsome assay (Ames test). Incubation with TM alone (200 μg/mL) did not alter the muscle twitch tension whereas incubation with venom (40 μg/mL) caused irreversible paralysis. Preincubation of TM (200 μg/mL) with venom attenuated the venom-induced neuromuscular blockade by 84% ± 5% (mean ± SEM; n = 4). The neuromuscular blockade caused by bothropstoxin-I (BthTX-I), the major myotoxic PLA2 of this venom, was also attenuated by TM. Histological analysis of diaphragm muscle incubated with TM showed that most fibers were preserved (only 9.2% ± 1.7% were damaged; n = 4) compared to venom alone (50.3% ± 5.4% of fibers damaged; n = 3), and preincubation of TM with venom significantly attenuated the venom-induced damage (only 17% ± 3.4% of fibers damaged; n = 3; p < 0.05 compared to venom alone). TM showed no mutagenicity in the Ames test using Salmonella strains TA98 and TA97a with (+S9) and without (-S9) metabolic activation. These findings indicate that TM is a potentially useful compound for antagonizing the neuromuscular effects (neurotoxicity and myotoxicity) of B. jararacussu venom.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The aim of the present study was to perform an in vitro analysis of the antimicrobial and antiproliferative potential of an extract from Anadenanthera colubrina (Vell.) Brenan (angico) and chemically characterize the crude extract. Antimicrobial action was evaluated based on the minimum inhibitory concentration (MIC), minimum bactericidal/fungicidal concentration, and the inhibition of formation to oral biofilm. Cell morphology was determined through scanning electron microscopy (SEM). Six strains of tumor cells were used for the determination of antiproliferative potential. The extract demonstrated strong antifungal activity against Candida albicans ATCC 18804 (MIC = 0.031 mg/mL), with similar activity found regarding the ethyl acetate fraction. The extract and active fraction also demonstrated the capacity to inhibit the formation of Candida albicans to oral biofilm after 48 hours, with median values equal to or greater than the control group, but the difference did not achieve statistical significance (P > 0.05). SEM revealed alterations in the cell morphology of the yeast. Regarding antiproliferative activity, the extract demonstrated cytostatic potential in all strains tested. The present findings suggest strong antifungal potential for Anadenanthera colubrina (Vell.) Brenan as well as a tendency toward diminishing the growth of human tumor cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Avian pathogenic Escherichia coli (APEC) strains belong to a category that is associated with colibacillosis, a serious illness in the poultry industry worldwide. Additionally, some APEC groups have recently been described as potential zoonotic agents. In this work, we compared APEC strains with extraintestinal pathogenic E. coli (ExPEC) strains isolated from clinical cases of humans with extra-intestinal diseases such as urinary tract infections (UTI) and bacteremia. PCR results showed that genes usually found in the ColV plasmid (tsh, iucA, iss, and hlyF) were associated with APEC strains while fyuA, irp-2, fepC sitDchrom, fimH, crl, csgA, afa, iha, sat, hlyA, hra, cnf1, kpsMTII, clpVSakai and malX were associated with human ExPEC. Both categories shared nine serogroups (O2, O6, O7, O8, O11, O19, O25, O73 and O153) and seven sequence types (ST10, ST88, ST93, ST117, ST131, ST155, ST359, ST648 and ST1011). Interestingly, ST95, which is associated with the zoonotic potential of APEC and is spread in avian E. coli of North America and Europe, was not detected among 76 APEC strains. When the strains were clustered based on the presence of virulence genes, most ExPEC strains (71.7%) were contained in one cluster while most APEC strains (63.2%) segregated to another. In general, the strains showed distinct genetic and fingerprint patterns, but avian and human strains of ST359, or ST23 clonal complex (CC), presented more than 70% of similarity by PFGE. The results demonstrate that some zoonotic-related STs (ST117, ST131, ST10CC, ST23CC) are present in Brazil. Also, the presence of moderate fingerprint similarities between ST359 E. coli of avian and human origin indicates that strains of this ST are candidates for having zoonotic potential.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In this work we report new silicon and germanium tubular nanostructures with no corresponding stable carbon analogues. The electronic and mechanical properties of these new tubes were investigated through ab initio methods. Our results show that these structures have lower energy than their corresponding nanoribbon structures and are stable up to high temperatures (500 and 1000 K, for silicon and germanium tubes, respectively). Both tubes are semiconducting with small indirect band gaps, which can be significantly altered by both compressive and tensile strains. Large bandgap variations of almost 50% were observed for strain rates as small as 3%, suggesting their possible applications in sensor devices. They also present high Young's modulus values (0.25 and 0.15 TPa, respectively). TEM images were simulated to help in the identification of these new structures.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Many Bacillus species can produce biosurfactant, although most of the studies on lipopeptide production by this genus have been focused on Bacillus subtilis. Surfactants are broadly used in pharmaceutical, food and petroleum industry, and biological surfactant shows some advantages over the chemical surfactants, such as less toxicity, production from renewable, cheaper feedstocks and development of novel recombinant hyperproducer strains. This study is aimed to unveil the biosurfactant metabolic pathway and chemical composition in Bacillus safensis strain CCMA-560. The whole genome of the CCMA-560 strain was previously sequenced, and with the aid of bioinformatics tools, its biosurfactant metabolic pathway was compared to other pathways of closely related species. Fourier transform infrared (FTIR) and high-resolution TOF mass spectrometry (MS) were used to characterize the biosurfactant molecule. B. safensis CCMA-560 metabolic pathway is similar to other Bacillus species; however, some differences in amino acid incorporation were observed, and chemical analyses corroborated the genetic results. The strain CCMA-560 harbours two genes flanked by srfAC and srfAD not present in other Bacillus spp., which can be involved in the production of the analogue gramicidin. FTIR and MS showed that B. safensis CCMA-560 produces a mixture of at least four lipopeptides with seven amino acids incorporated and a fatty acid chain with 14 carbons, which makes this molecule similar to the biosurfactant of Bacillus pumilus, namely, pumilacidin. This is the first report on the biosurfactant production by B. safensis, encompassing the investigation of the metabolic pathway and chemical characterization of the biosurfactant molecule.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

All-trans retinoic acid (atRA) maintains physiological stability of the prostate, and we reported that ethanol intake increases atRA in the rat prostate; however the mechanisms underlying these changes are unknown. We evaluated the impact of a low- and high-dose ethanol intake (UChA and UChB strains) on atRA metabolism in the dorsal and lateral prostate. Aldehyde dehydrogenase (ALDH) subtype 1A3 was increased in the dorsal prostate of UChA animals while ALDH1A1 and ALDH1A2 decreased in the lateral prostate. In UChB animals, ALDH1A1, ALDH1A2, and ALDH1A3 increased in the dorsal prostate, and ALDH1A3 decreased in the lateral prostate. atRA levels increased with the low activity of CYP2E1 and decreased with high CYP26 activity in the UChB dorsal prostate. Conversely, atRA was found to decrease when the activity of total CYP was increased in the UChA lateral prostate. Ethanol modulates the synthesis and catabolism of atRA in the prostate in a concentration-dependent manner.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.