Meningencefalites bacterianas agudas em crianças: complicações e sequelas neurológicas

We studied 271 children under age of 15 with diagnosis of acute bacterial meningencephalitis treated at Medical School in Ribeirão Preto, University of São Paulo, between 1980 and 1990. The patients were divided in two groups: 1) those who had not received previous antibiotics treatment (NTP), with 153 cases; and 2), those who had received previous antibiotics treatment (PT), with 118 cases. The etiological agent was more frequently identified in NPT group, while ventriculitis was more frequent in PT group. Mortality rate accounted for 19,5% of all cases, and 29.7% of children under 12 months of age. Acute meningitis caused by Streptococcus pneumoniae was frequently followed by increased mortality. Convulsive disorders and hemiparesis predominante among children under 12 months of age. On the neurosurgical point of view, ventriculitis, subdural hygroma, hydrocephalus, subdural empyema and brain abscess were identified and treated

Lingüística textual: quo vadis?

This paper aims to discuss the future -- and the proper survival of Textlinguistics this millenium, and the challenges it has to face in order to contribute to the development of Human Sciences in a new era.

Ocorrência de fungos filamentosos termo-resistentes em polpa de tomate envasada assepticamente

This work aimed at determining the occurrence of heat resistant molds during the aseptic processing of tomato pulp (8° BRIX). During tomato harvest, 9 lots were sampled (3 at the beginning, 3 at the apex and 3 at the end of harvest) and other 5 lots were sampled between harvest. For each lot, the enumeration of heat resistant molds was carried out in samples collected during the aseptic process. The mean count of heat resistant molds was relatively low, ranging from <1 to 8CFU/100mL of sample. The higher counts were observed in the raw material and the pre-wash and transportation water. Fifty strains of heat resistant molds detected in the enumeration procedure were isolated, codified and stocked. One-month-old spores of each isolate were submitted to different heat shocks to select the most heat resistant mold. The most heat resistant isolated strain (survived 100° C/25 minutes) was identified as Neosartorya fischeri.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Meningites bacterianas agudas complicações vasculares: vascular complications

The authors present the study of four children with arteritis as vascular complication of acute bacterial meningitis. They report pathophysiological mechanisms involved in vascular lesions, and progress in the understanding of these complications.