Optical And Nonoptical Aids For Reading And Writing In Individuals With Acquired Low Vision.

To evaluate the use of optical and nonoptical aids during reading and writing activities in individuals with acquired low vision. This study was performed using descriptive and cross-sectional surveys. The data collection instrument was created with structured questions that were developed from an exploratory study and a previous test based on interviews, and it evaluated the following variables: personal characteristics, use of optical and nonoptical aids, and activities that required the use of optical and nonoptical aids. The study population included 30 subjects with acquired low vision and visual acuities of 20/200-20/400. Most subjects reported the use of some optical aids (60.0%). Of these 60.0%, the majority (83.3%) cited spectacles as the most widely used optical aid. The majority (63.3%) of subjects also reported the use of nonoptical aids, the most frequent ones being letter magnification (68.4%), followed by bringing the objects closer to the eyes (57.8%). Subjects often used more than one nonoptical aid. The majority of participants reported the use of optical and nonoptical aids during reading activities, highlighting the use of spectacles, magnifying glasses, and letter magnification; however, even after the use of these aids, we found that the subjects often needed to read the text more than once to understand it. During writing activities, all subjects reported the use of optical aids, while most stated that they did not use nonoptical aids for such activities.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.