Leaf-, Panel- And Latex-expressed Sequenced Tags From The Rubber Tree (hevea Brasiliensis) Under Cold-stressed And Suboptimal Growing Conditions: The Development Of Gene-targeted Functional Markers For Stress Response.

Hevea brasiliensis is a native species of the Amazon Basin of South America and the primary source of natural rubber worldwide. Due to the occurrence of South American Leaf Blight disease in this area, rubber plantations have been extended to suboptimal regions. Rubber tree breeding is time-consuming and expensive, but molecular markers can serve as a tool for early evaluation, thus reducing time and costs. In this work, we constructed six different cDNA libraries with the aim of developing gene-targeted molecular markers for the rubber tree. A total of 8,263 reads were assembled, generating 5,025 unigenes that were analyzed; 912 expressed sequence tags (ESTs) represented new transcripts, and two sequences were highly up-regulated by cold stress. These unigenes were scanned for microsatellite (SSR) regions and single nucleotide polymorphisms (SNPs). In total, 169 novel EST-SSR markers were developed; 138 loci were polymorphic in the rubber tree, and 98 % presented transferability to six other Hevea species. Locus duplication was observed in H. brasiliensis and other species. Additionally, 43 SNP markers in 13 sequences that showed similarity to proteins involved in stress response, latex biosynthesis and developmental processes were characterized. cDNA libraries are a rich source of SSR and SNP markers and enable the identification of new transcripts. The new markers developed here will be a valuable resource for linkage mapping, QTL identification and other studies in the rubber tree and can also be used to evaluate the genetic variability of other Hevea species, which are valuable assets in rubber tree breeding.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

As conferências nacionais do esporte na configuração da política esportiva e de lazer no governo Lula (2003-2010)

Universidade Estadual de Campinas . Faculdade de Educação Física

Proposição e avaliação de um método baseado em projeção de luz para reconstrução e análise da superfície do tronco durante a respiração

Universidade Estadual de Campinas . Faculdade de Educação Física

Futebol : Analises qualitativas e quantitativas para verificação e modulação de padrões e sistemas complexos de jogo

Universidade Estadual de Campinas . Faculdade de Educação Física

Avaliação da qualidade de vida de um grupo de tabagistas participantes de um programa interdisciplinar em Centro de Saude

Universidade Estadual de Campinas . Faculdade de Educação Física

Variabilidade da frequencia cardiaca : estudo das influencias autonomicas sobre suas caracteristicas temporal e espectral em halterofilistas e sedentarios

Universidade Estadual de Campinas. Faculdade de Educação Física

Contribuições dos programas de pos-graduação stricto sensu na formação e atuação dos docentes de ensino superior : o caso da educação fisica

Universidade Estadual de Campinas . Faculdade de Educação Física

Metodologia para descrição tridimensional do movimento humano a partir de cameras de video não sincronizadas

Universidade Estadual de Campinas. Faculdade de Educação Física

Concepção e implementação de um sistema para analise cinematica de movimentos humanos

Universidade Estadual de Campinas. Faculdade de Educação Física

Inter-relações de turistas e moradores : um olhar atraves das manifestações corporais no Carnaval de Ouro Preto

Universidade Estadual de Campinas. Faculdade de Educação Física

Metodologia para determinação dos volumes do tronco durante a respiração usando projeção de luz e reconstrução de superficie

Universidade Estadual de Campinas . Faculdade de Educação Física

Rastreamento automatico de trajetorias de jogadores de futebol por videogrametria : validação do metodo e analise dos resultados

Universidade Estadual de Campinas . Faculdade de Educação Física