5 resultados para recurrent events
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Hereditary angioedema (HAE) with C1 inhibitor deficiency manifests as recurrent episodes of edema involving the skin, upper respiratory tract and gastrointestinal tract. It can be lethal due to asphyxia. The aim here was to evaluate the response to therapy for these attacks using icatibant, an inhibitor of the bradykinin receptor, which was recently introduced into Brazil. Prospective experimental single-cohort study on the efficacy and safety of icatibant for HAE patients. Patients with a confirmed HAE diagnosis were enrolled according to symptoms and regardless of the time since onset of the attack. Icatibant was administered in accordance with the protocol that has been approved in Brazil. Symptom severity was assessed continuously and adverse events were monitored. 24 attacks in 20 HAE patients were treated (female/male 19:1; 19-55 years; median 29 years of age). The symptoms were: subcutaneous edema (22/24); abdominal pain (15/24) and upper airway obstruction (10/24). The time taken until onset of relief was: 5-10 minutes (5/24; 20.8%); 10-20 (5/24; 20.8%); 20-30 (8/24; 33.4%); 30-60 (5/24; 20.8%); and 2 hours (1/24; 4.3%). The time taken for complete resolution of symptoms ranged from 4.3 to 33.4 hours. Adverse effects were only reported at injection sites. Mild to moderate erythema and/or feelings of burning were reported by 15/24 patients, itching by 3 and no adverse effects in 6. HAE type I patients who received icatibant responded promptly; most achieved improved symptom severity within 30 minutes. Local adverse events occurred in 75% of the patients.
Resumo:
This study tested whether myocardial extracellular volume (ECV) is increased in patients with hypertension and atrial fibrillation (AF) undergoing pulmonary vein isolation and whether there is an association between ECV and post-procedural recurrence of AF. Hypertension is associated with myocardial fibrosis, an increase in ECV, and AF. Data linking these findings are limited. T1 measurements pre-contrast and post-contrast in a cardiac magnetic resonance (CMR) study provide a method for quantification of ECV. Consecutive patients with hypertension and recurrent AF referred for pulmonary vein isolation underwent a contrast CMR study with measurement of ECV and were followed up prospectively for a median of 18 months. The endpoint of interest was late recurrence of AF. Patients had elevated left ventricular (LV) volumes, LV mass, left atrial volumes, and increased ECV (patients with AF, 0.34 ± 0.03; healthy control patients, 0.29 ± 0.03; p < 0.001). There were positive associations between ECV and left atrial volume (r = 0.46, p < 0.01) and LV mass and a negative association between ECV and diastolic function (early mitral annular relaxation [E'], r = -0.55, p < 0.001). In the best overall multivariable model, ECV was the strongest predictor of the primary outcome of recurrent AF (hazard ratio: 1.29; 95% confidence interval: 1.15 to 1.44; p < 0.0001) and the secondary composite outcome of recurrent AF, heart failure admission, and death (hazard ratio: 1.35; 95% confidence interval: 1.21 to 1.51; p < 0.0001). Each 10% increase in ECV was associated with a 29% increased risk of recurrent AF. In patients with AF and hypertension, expansion of ECV is associated with diastolic function and left atrial remodeling and is a strong independent predictor of recurrent AF post-pulmonary vein isolation.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.