Interplay Between Cell Growth And Cell Cycle In Plants.

The growth of organs and whole plants depends on both cell growth and cell-cycle progression, but the interaction between both processes is poorly understood. In plants, the balance between growth and cell-cycle progression requires coordinated regulation of four different processes: macromolecular synthesis (cytoplasmic growth), turgor-driven cell-wall extension, mitotic cycle, and endocycle. Potential feedbacks between these processes include a cell-size checkpoint operating before DNA synthesis and a link between DNA contents and maximum cell size. In addition, key intercellular signals and growth regulatory genes appear to target at the same time cell-cycle and cell-growth functions. For example, auxin, gibberellin, and brassinosteroid all have parallel links to cell-cycle progression (through S-phase Cyclin D-CDK and the anaphase-promoting complex) and cell-wall functions (through cell-wall extensibility or microtubule dynamics). Another intercellular signal mediated by microtubule dynamics is the mechanical stress caused by growth of interconnected cells. Superimposed on developmental controls, sugar signalling through the TOR pathway has recently emerged as a central control point linking cytoplasmic growth, cell-cycle and cell-wall functions. Recent progress in quantitative imaging and computational modelling will facilitate analysis of the multiple interconnections between plant cell growth and cell cycle and ultimately will be required for the predictive manipulation of plant growth.

Screening The Life Cycle Of Schistosoma Mansoni Using High-resolution Mass Spectrometry.

Schistosomiasis is a common tropical disease caused by Schistosoma species Schistosomiasis' pathogenesis is known to vary according to the worms' strain. Moreover, high parasitical virulence is directly related to eggs release and granulomatous inflammation in the host's organs. This virulence might be influenced by different classes of molecules, such as lipids. Therefore, better understanding of the metabolic profile of these organisms is necessary, especially for an increased potential of unraveling strain virulence mechanisms and resistance to existing treatments. In this report, direct-infusion electrospray high-resolution mass spectrometry (ESI(+)-HRMS) along with the lipidomic platform were employed to rapidly characterize and differentiate two Brazilian S. mansoni strains (BH and SE) in three stages of their life cycle: eggs, miracidia and cercariae, with samples from experimental animals (Swiss/SPF mice). Furthermore, urine samples of the infected and uninfected mice were analyzed to assess the possibility of direct diagnosis. All samples were differentiated using multivariate data analysis, PCA, which helped electing markers from distinct lipid classes; phospholipids, diacylglycerols and triacylglycerols, for example, clearly presented different intensities in some stages and strains, as well as in urine samples. This indicates that biochemical characterization of S. mansoni may help narrowing-down the investigation of new therapeutic targets according to strain composition and aggressiveness of disease. Interestingly, lipid profile of infected mice urine varies when compared to control samples, indicating that direct diagnosis of schistosomiasis from urine may be feasible.

[meanings Of The Sickening Process For Patients With Systemic Lupus Erythematosus: A Review Of The Literature.]

Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.

Polymorphisms Of Cell Cycle Control Genes Influence The Development Of Sporadic Medullary Thyroid Carcinoma.

The role of key cell cycle regulation genes such as, CDKN1B, CDKN2A, CDKN2B, and CDKN2C in sporadic medullary thyroid carcinoma (s-MTC) is still largely unknown. In order to evaluate the influence of inherited polymorphisms of these genes on the pathogenesis of s-MTC, we used TaqMan SNP genotyping to examine 45 s-MTC patients carefully matched with 98 controls. A multivariate logistic regression analysis demonstrated that CDKN1B and CDKN2A genes were related to s-MTC susceptibility. The rs2066827*GT+GG CDKN1B genotype was more frequent in s-MTC patients (62.22%) than in controls (40.21%), increasing the susceptibility to s-MTC (OR=2.47; 95% CI=1.048-5.833; P=0.038). By contrast, the rs11515*CG+GG of CDKN2A gene was more frequent in the controls (32.65%) than in patients (15.56%), reducing the risk for s-MTC (OR=0.174; 95% CI=0.048-0.627; P=0.0075). A stepwise regression analysis indicated that two genotypes together could explain 11% of the total s-MTC risk. In addition, a relationship was found between disease progression and the presence of alterations in the CDKN1A (rs1801270), CDKN2C (rs12885), and CDKN2B (rs1063192) genes. WT rs1801270 CDKN1A patients presented extrathyroidal tumor extension more frequently (92%) than polymorphic CDKN1A rs1801270 patients (50%; P=0.0376). Patients with the WT CDKN2C gene (rs12885) presented larger tumors (2.9±1.8 cm) than polymorphic patients (1.5±0.7 cm; P=0.0324). On the other hand, patients with the polymorphic CDKN2B gene (rs1063192) presented distant metastases (36.3%; P=0.0261). In summary, we demonstrated that CDKN1B and CDKN2A genes are associated with susceptibility, whereas the inherited genetic profile of CDKN1A, CDKN2B, and CDKN2C is associated with aggressive features of tumors. This study suggests that profiling cell cycle genes may help define the risk and characterize s-MTC aggressiveness.

[in Process Citation].

20

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Sistema de análise de movimento para avaliação da postura vertical durante a corrida no teste de esforço máximo incremental

Universidade Estadual de Campinas . Faculdade de Educação Física

O aluno com deficiência visual nas aulas de educação física : análise do processo inclusivo = The student with visual impairments : analysis of inclusive process

Universidade Estadual de Campinas . Faculdade de Educação Física

Hegemonia e contra-hegemonia na construção de políticas de esporte e lazer : a experiência do Consórcio Brasília = Hegemony and counter-hegemony in the process of sport and leisure policy-making : the experience of the Consortium Brasilia

Universidade Estadual de Campinas . Faculdade de Educação Física

A educação fisica na rede publica do municipio de São João da Boa Vista - SP e o portador de necessidade especiais

Universidade Estadual de Campinas. Faculdade de Educação Física