2 resultados para polinização por moscas
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
This survey aimed at describing the interactions of floral visitors and Davilla kunthii A. St.-Hil. as well as characteristics of its reproductive biology in Itacoatiara, state of Amazonas, Brazil. Tests of the breeding system were performed. The guild of visitors was described according to richness, abundance, relative frequency and constancy. The breeding system tests indicated that D. kunthii is self-compatible. The pollination system was characterized as generalist, with 39 visitor species, from three different orders. Bees were the main group of pollinators, thus some behavioural aspects were described. Th e period of highest foraging activity was between 7 and 10 am. Some species presented agonistic and monopolistic behaviour. Given the behaviour and destructive potential, the Curculionidae seem to have a greater impact as seed predators than pollinators.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.