Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

The Burden Of Eclampsia: Results From A Multicenter Study On Surveillance Of Severe Maternal Morbidity In Brazil.

Maternal mortality (MM) is a core indicator of disparities in women's rights. The study of Near Miss cases is strategic to identifying the breakdowns in obstetrical care. In absolute numbers, both MM and occurrence of eclampsia are rare events. We aim to assess the obstetric care indicators and main predictors for severe maternal outcome from eclampsia (SMO: maternal death plus maternal near miss). Secondary analysis of a multicenter, cross-sectional study, including 27 centers from all geographic regions of Brazil, from 2009 to 2010. 426 cases of eclampsia were identified and classified according to the outcomes: SMO and non-SMO. We classified facilities as coming from low- and high-income regions and calculated the WHO's obstetric health indicators. SPSS and Stata softwares were used to calculate the prevalence ratios (PR) and respective 95% confidence interval (CI) to assess maternal characteristics, clinical and obstetrical history, and access to health services as predictors for SMO, subsequently correlating them with the corresponding perinatal outcomes, also applying multiple regression analysis (adjusted for cluster effect). Prevalence of and mortality indexes for eclampsia in higher and lower income regions were 0.2%/0.8% and 8.1%/22%, respectively. Difficulties in access to health care showed that ICU admission (adjPR 3.61; 95% CI 1.77-7.35) and inadequate monitoring (adjPR 2.31; 95% CI 1.48-3.59) were associated with SMO. Morbidity and mortality associated with eclampsia were high in Brazil, especially in lower income regions. Promoting quality maternal health care and improving the availability of obstetric emergency care are essential actions to relieve the burden of eclampsia.

Comparação entre diferentes ciclo simuladores e ciclismo em velódromo : testes de desempenho máximo de 5 quilômetros

Universidade Estadual de Campinas . Faculdade de Educação Física