Molecular Genetic Variability Of Commercial And Wild Accessions Of Passion Fruit (passiflora Spp.) Targeting Ex Situ Conservation And Breeding.

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Genetic Breeding And Diversity Of The Genus Passiflora: Progress And Perspectives In Molecular And Genetic Studies.

Despite the ecological and economic importance of passion fruit (Passiflora spp.), molecular markers have only recently been utilized in genetic studies of this genus. In addition, both basic genetic researches related to population studies and pre-breeding programs of passion fruit remain scarce for most Passiflora species. Considering the number of Passiflora species and the increasing use of these species as a resource for ornamental, medicinal, and food purposes, the aims of this review are the following: (i) to present the current condition of the passion fruit crop; (ii) to quantify the applications and effects of using molecular markers in studies of Passiflora; (iii) to present the contributions of genetic engineering for passion fruit culture; and (iv) to discuss the progress and perspectives of this research. Thus, the present review aims to summarize and discuss the relationship between historical and current progress on the culture, breeding, and molecular genetics of passion fruit.

New Microsatellite Markers For Wild And Commercial Species Of Passiflora (passifloraceae) And Cross-amplification.

• We developed the first microsatellites for Passiflora setacea and characterized new sets of markers for P. edulis and P. cincinnata, enabling further genetic diversity studies to support the conservation and breeding of passion fruit species. • We developed 69 microsatellite markers and, in conjunction with assessments of cross-amplification using primers available from the literature, present 43 new polymorphic microsatellite loci for three species of Passiflora. The mean number of alleles per locus was 3.1, and the mean values of the expected and observed levels of heterozygosity were 0.406 and 0.322, respectively. • These microsatellite markers will be valuable tools for investigating the genetic diversity and population structure of wild and commercial species of passion fruit (Passiflora spp.) and may be useful for developing conservation and improvement strategies by contributing to the understanding of the mating system and hybridization within the genus.

Condutividade e difusividade térmica do figo (Ficus carica L.) Roxo de Valinhos

The post harvest cooling and/or freezing processes for horticultural products have been carried out with the objective of removing the heat from these products, allowing them a bigger period of conservation. Therefore, the knowledge of the physical properties that involve heat transference in the fig fruit Roxo de Valinhos is useful for calculating projects and systems of food engineering in general, as well as, for using in equations of thermodynamic mathematical models. The values of conductivity and thermal diffusivity of the whole fig fruit-rami index were determined, and from these values it was determined the value of the specific heat. For these determination it was used the transient method of the Line Heat Source. The results shown that the fig fruit has a thermal conductivity of 0.52 W m-1°C, thermal diffusivity of 1.56 x 10-7 m² s-1, pulp density of 815.6 kg m-3 and specific heat of 4.07 kJ kg-1 °C.

Utilização de 1-metilciclopropeno e resfriamento rápido na conservação de pêssegos

Postharvest losses vary among the different vegetable products. However, among fruits and vegetables the losses generally range from 30% to 50%. Thus, this paper aimed the application of 1-methylcycloprene (1-MCP) and fast cooling with forced air (PC) on peaches, in order to estimate their effects in the ripening process of this fruit. Physiological analyses were performed, such as loss of fresh mass, firmness, pH, titratable acidity, soluble solids, ratio and CO2 production, as well as sensorial analyses such as color, texture and flavor. The experiment was divided in two phases. In the first one, concentrations of 30, 60, and 90 nL/L 1-MCP, applied at 0 ºC and 20 ºC, were tested. The fruits treated without 1-MCP were denominated control for both temperatures studied. The second phase was composed by the following treatments: cold storage (CS) or control, cooling with forced air (CFA), cooling with forced air followed by 1-MCP application (CFA + 1-MCP) and 1-MCP application (1-MCP). Among these, the CFA + 1-MCP treatment provided more firmness of the fruits in comparison to the control fruits. The respiratory rate of peaches under CFA and CFA + 1-MCP treatments decreased in comparison to the control fruit respiratory rates.

Aspectos ultra-estruturais dos canais secretores em órgãos vegetativos e reprodutivos de Anacardiaceae

The study assessed phloem canal development and ultra-structure in shoot apices of Spondias dulcis G. Forst., phloematic canal ultra-structure in shoot apices of Tapirira guianensis Aubl., and floral canal ultra-structure and development and fruit canal ultra-structure of the latter specie. The flower and fruit canals of Anacardium humile St.Hil. were also studied ultra-structurally. The canals in shoot apices of S. dulcis show schizo-lysigenous formation and the floral canals of T. guianensis show schizogenous development. Epithelial cells of S. dulcis and T. guianensis canals have rough endoplasmic reticulum, free ribosomes, elongated plastids of several shapes with osmiophilic inclusions and dictyosomes with production of vesicles. Such organelles participate in the secretion of a heterogeneous exudate, which is comprised of hydrophilic and lipophilic substances. The epithelial cells of the fruit of A. humile present elongated plastids with circular membrane system, which are involved in the synthesis of lipophilic substances. The results of the ultra-structural analyses of the epithelial cells corroborate the results previously obtained in a histochemical study. In the histochemical study, lipophilic and hydrophilic substances were identified in the canals of T. guinanensis and S. dulcis and only lipophilic substances were identified in the canals of A. humile. Based on the ultrastructural aspects of the secretory canals of T. guianensis and S. dulcis we concluded that the plastids of the epithelial cells of the two species are different although they produce secretion of similar composition. A new record for the family is the presence of a great number of circular plastids in epithelial cells of the fruit of Anacardium humile. The pattern found in the secretory canals of the studied species is the ecrine type of secretion release.