Molecular Genetic Variability Of Commercial And Wild Accessions Of Passion Fruit (passiflora Spp.) Targeting Ex Situ Conservation And Breeding.

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Genetic Breeding And Diversity Of The Genus Passiflora: Progress And Perspectives In Molecular And Genetic Studies.

Despite the ecological and economic importance of passion fruit (Passiflora spp.), molecular markers have only recently been utilized in genetic studies of this genus. In addition, both basic genetic researches related to population studies and pre-breeding programs of passion fruit remain scarce for most Passiflora species. Considering the number of Passiflora species and the increasing use of these species as a resource for ornamental, medicinal, and food purposes, the aims of this review are the following: (i) to present the current condition of the passion fruit crop; (ii) to quantify the applications and effects of using molecular markers in studies of Passiflora; (iii) to present the contributions of genetic engineering for passion fruit culture; and (iv) to discuss the progress and perspectives of this research. Thus, the present review aims to summarize and discuss the relationship between historical and current progress on the culture, breeding, and molecular genetics of passion fruit.

New Microsatellite Markers For Wild And Commercial Species Of Passiflora (passifloraceae) And Cross-amplification.

• We developed the first microsatellites for Passiflora setacea and characterized new sets of markers for P. edulis and P. cincinnata, enabling further genetic diversity studies to support the conservation and breeding of passion fruit species. • We developed 69 microsatellite markers and, in conjunction with assessments of cross-amplification using primers available from the literature, present 43 new polymorphic microsatellite loci for three species of Passiflora. The mean number of alleles per locus was 3.1, and the mean values of the expected and observed levels of heterozygosity were 0.406 and 0.322, respectively. • These microsatellite markers will be valuable tools for investigating the genetic diversity and population structure of wild and commercial species of passion fruit (Passiflora spp.) and may be useful for developing conservation and improvement strategies by contributing to the understanding of the mating system and hybridization within the genus.

Determination Of The Phenolic Composition From Brazilian Tropical Fruits By Uhplc-ms/ms.

Although Brazil is the third largest fruit producer in the world, several specimens consumed are not well studied from the chemical viewpoint, especially for quantitative analysis. For this reason and the crescent employment of mass spectrometry (MS) techniques in food science we selected twenty-two phenolic compounds with important biological activities and developed an ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) method using electrospray (ESI) in negative ion mode aiming their quantification in largely consumed Brazilian fruits (açaí-do-Amazonas, acerola, cashew apple, camu-camu, pineapple and taperebá). Multiple reaction monitoring (MRM) was applied and the selection of proper product ions for each transition assured high selectivity. Linearity (0.99580%), precision (CV<20%) and extraction recovery rate (>80%) were satisfactory and showed that the method provides an efficient protocol to analyze phenolic compounds in fruit pulp extracts.

Ambientes de cultivo, recipientes e substratos na produção de biomassa foliar e radicular em mudas de maracujazeiro amarelo em Aquidauana - MS

The objective of the work was to evaluate the effects of environment, recipients, and substrate compositions in passion fruit (Passiflora edulis Sims f. flavicarpa Deg.) seedlings biomass production in Pantanal region from September to November of 2006. Experimental trials were conducted in four protected environments, in two types of containers and three different substrate compositions. The environments were: A1 (greenhouse covered with low-density, 150-microns-thick polyethylene film), A2 (monofilament black screened with mesh for 50% of shade), A3 (aluminized screened with mesh for 50% of shade) and A4 (environment covered with straw of native coconut palm); the recipients were: polyethylene bags (R1) (15 x 25 cm) and polystyrene trays (R2) (with 72 cells). There substrates were: S1 (soil + organic compost + vermiculite, 1:1: 1 v/v), S2 (soil + organic compost + sawdust, 1:1: 1 v/v) and S3 (soil + organic compost + vermiculite + sawdust, 1:1: 1/2: 1/2 v/v). The experimental design was completely randomized statistical analysis in split-split-plot, with fifteen replications. The treatments in the plot were environments, in the subplots were pots, and subsubplots were substrates (4 x 2 x 3 = 24 treatments). Fresh and dry mass of aerial and root system parts were evaluated. Environments with screen showed better results for seedlings of yellow passion fruit biomass in polyethylene bags. Polyethylene bags promoted higher biomasses. The substrate with vermiculite showed better results for both types of containers. The substrate with a higher percentage of sawdust showed the worst result.

Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Microbial Evaluation Of Traumatized Teeth Treated With Triple Antibiotic Paste Or Calcium Hydroxide With 2% Chlorhexidine Gel In Pulp Revascularization.

Revascularization outcome depends on microbial elimination because apical repair will not happen in the presence of infected tissues. This study evaluated the microbial composition of traumatized immature teeth and assessed their reduction during different stages of the revascularization procedures performed with 2 intracanal medicaments. Fifteen patients (7-17 years old) with immature teeth were submitted to the revascularization procedures; they were divided into 2 groups according to the intracanal medicament used: TAP group (n = 7), medicated with a triple antibiotic paste, and CHP group (n = 8), dressed with calcium hydroxide + 2% chlorhexidine gel. Samples were taken before any treatment (S1), after irrigation with 6% NaOCl (S2), after irrigation with 2% chlorhexidine (S3), after intracanal dressing (S4), and after 17% EDTA irrigation (S5). Cultivable bacteria recovered from the 5 stages were counted and identified by means of polymerase chain reaction assay (16S rRNA). Both groups had colony-forming unit counts significantly reduced after S2 (P < .05); however, no significant difference was found between the irrigants (S2 and S3, P = .99). No difference in bacteria counts was found between the intracanal medicaments used (P = .95). The most prevalent bacteria detected were Actinomyces naeslundii (66.67%), followed by Porphyromonas endodontalis, Parvimonas micra, and Fusobacterium nucleatum, which were detected in 33.34% of the root canals. An average of 2.13 species per canal was found, and no statistical correlation was observed between bacterial species and clinical/radiographic features. The microbial profile of infected immature teeth is similar to that of primarily infected permanent teeth. The greatest bacterial reduction was promoted by the irrigation solutions. The revascularization protocols that used the tested intracanal medicaments were efficient in reducing viable bacteria in necrotic immature teeth.

Polyphenol Extraction Optimisation From Ceylon Gooseberry (dovyalis Hebecarpa) Pulp.

Originally from Asia, Dovyalis hebecarpa is a dark purple/red exotic berry now also produced in Brazil. However, no reports were found in the literature about phenolic extraction or characterisation of this berry. In this study we evaluate the extraction optimisation of anthocyanins and total phenolics in D. hebecarpa berries aiming at the development of a simple and mild analytical technique. Multivariate analysis was used to optimise the extraction variables (ethanol:water:acetone solvent proportions, times, and acid concentrations) at different levels. Acetone/water (20/80 v/v) gave the highest anthocyanin extraction yield, but pure water and different proportions of acetone/water or acetone/ethanol/water (with >50% of water) were also effective. Neither acid concentration nor time had a significant effect on extraction efficiency allowing to fix the recommended parameters at the lowest values tested (0.35% formic acid v/v, and 17.6 min). Under optimised conditions, extraction efficiencies were increased by 31.5% and 11% for anthocyanin and total phenolics, respectively as compared to traditional methods that use more solvent and time. Thus, the optimised methodology increased yields being less hazardous and time consuming than traditional methods. Finally, freeze-dried D. hebecarpa showed high content of target phytochemicals (319 mg/100g and 1,421 mg/100g of total anthocyanin and total phenolic content, respectively).

Micromorphology Of The Dental Pulp Is Highly Preserved In Cancer Patients Who Underwent Head And Neck Radiotherapy.

Teeth are often included in the radiation field during head and neck radiotherapy, and recent clinical evidence suggests that dental pulp is negatively affected by the direct effects of radiation, leading to impaired sensitivity of the dental pulp. Therefore, this study aimed to investigate the direct effects of radiation on the microvasculature, innervation, and extracellular matrix of the dental pulp of patients who have undergone head and neck radiotherapy. Twenty-three samples of dental pulp from patients who finished head and neck radiotherapy were analyzed. Samples were histologically processed and stained with hematoxylin-eosin for morphologic evaluation of the microvasculature, innervation, and extracellular matrix. Subsequently, immunohistochemical analysis of proteins related to vascularization (CD34 and smooth muscle actin), innervation (S-100, NCAM/CD56, and neurofilament), and extracellular matrix (vimentin) of the dental pulp was performed. The morphologic study identified preservation of the microvasculature, nerve bundles, and components of the extracellular matrix in all studied samples. The immunohistochemical analysis confirmed the morphologic findings and showed a normal pattern of expression for the studied proteins in all samples. Direct effects of radiotherapy are not able to generate morphologic changes in the microvasculature, innervation, and extracellular matrix components of the dental pulp in head and neck cancer patients.

Anthocyanin And Other Phenolic Compounds In Ceylon Gooseberry (dovyalis Hebecarpa) Fruits.

Ceylon gooseberry is a deep-purple exotic berry that is being produced in Brazil with great market potential. This work aimed to determine major phenolic compounds in this specie by HPLC-PDA-ESI/MS. Samples were collected in two different seasons. Pulp and skin were analyzed separately. Non-acylated rutinoside derivatives of delphinidin (∼60-63%) and cyanidin (∼17-21%) were major anthocyanins tentatively identified. All anthocyanins had higher concentration in skin than in pulp (64-82 and 646-534mg of cyaniding-3-glucoside equivalents/100g skin and pulp, respectively). Moreover, anthocyanin profile changed between sampling dates (p<0.05). Mainly for delphinidin-3-rutinoside which could be a result of season variation. In this specie, non-anthocyanin polyphenols represent less than 35% of total extracted polyphenols. The tentative identification proposed a flavonol and three ellagitannins as major compounds of the non-anthocyanin phenolics fraction. Finally, anthocyanin is the major phenolic class in this fruit and its composition and content are significantly affected by season.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Condutividade e difusividade térmica do figo (Ficus carica L.) Roxo de Valinhos

The post harvest cooling and/or freezing processes for horticultural products have been carried out with the objective of removing the heat from these products, allowing them a bigger period of conservation. Therefore, the knowledge of the physical properties that involve heat transference in the fig fruit Roxo de Valinhos is useful for calculating projects and systems of food engineering in general, as well as, for using in equations of thermodynamic mathematical models. The values of conductivity and thermal diffusivity of the whole fig fruit-rami index were determined, and from these values it was determined the value of the specific heat. For these determination it was used the transient method of the Line Heat Source. The results shown that the fig fruit has a thermal conductivity of 0.52 W m-1°C, thermal diffusivity of 1.56 x 10-7 m² s-1, pulp density of 815.6 kg m-3 and specific heat of 4.07 kJ kg-1 °C.

Avaliação de linhas de beneficiamento e impactos de queda na qualidade de caqui Rama Forte

Excessive and inadequate handling of fruits and vegetables provides high incidences of physical damage, consequently, post harvest losses. The main goal of this work was to evaluate the impact magnitude in persimmon packing lines, Rama Forte, and to determine, at the laboratory, its impact limits. For evaluating the critical points it was used an instrumented sphere of 76 mm of diameter (Technmark, Inc, Lansing, USA), which registered the impact magnitude in seven distinctive impact lines located in four packing houses. For determining physical damages, tests were carried out at the laboratory, where fruit drop was related to impact magnitude, physical damage incidence and fruit post harvest losses. At the packing lines, the values found varied from 21 to 87 G on the transfer points and the majority of registered impacts (over 94%) were down 50G. Drops from 20 cm caused an increase in weight losses after six days of storage at room temperature. Drops from 20 and 30 cm caused skin darkness (low L values), associated to a decrease in color intensity (chroma). Impact drop did not affect pulp fruit chemical features.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.