Contribution Of Antepartum And Intrapartum Hemorrhage To The Burden Of Maternal Near Miss And Death In A National Surveillance Study

Objective To evaluate the occurrence of severe obstetric complications associated with antepartum and intrapartum hemorrhage among women from the Brazilian Network for Surveillance of Severe Maternal Morbidity.Design Multicenter cross-sectional study.Setting Twenty-seven obstetric referral units in Brazil between July 2009 and June 2010.Population A total of 9555 women categorized as having obstetric complications.Methods The occurrence of potentially life-threatening conditions, maternal near miss and maternal deaths associated with antepartum and intrapartum hemorrhage was evaluated. Sociodemographic and obstetric characteristics and the use of criteria for management of severe bleeding were also assessed in these women.Main outcome measures The prevalence ratios with their respective 95% confidence intervals adjusted for the cluster effect of the design, and multiple logistic regression analysis were performed to identify factors independently associated with the occurrence of severe maternal outcome.Results Antepartum and intrapartum hemorrhage occurred in only 8% (767) of women experiencing any type of obstetric complication. However, it was responsible for 18.2% (140) of maternal near miss and 10% (14) of maternal death cases. On multivariate analysis, maternal age and previous cesarean section were shown to be independently associated with an increased risk of severe maternal outcome (near miss or death).Conclusion Severe maternal outcome due to antepartum and intrapartum hemorrhage was highly prevalent among Brazilian women. Certain risk factors, maternal age and previous cesarean delivery in particular, were associated with the occurrence of bleeding.

Contribution Of Antepartum And Intrapartum Hemorrhage To The Burden Of Maternal Near Miss And Death In A National Surveillance Study.

To evaluate the occurrence of severe obstetric complications associated with antepartum and intrapartum hemorrhage among women from the Brazilian Network for Surveillance of Severe Maternal Morbidity. Multicenter cross-sectional study. Twenty-seven obstetric referral units in Brazil between July 2009 and June 2010. A total of 9555 women categorized as having obstetric complications. The occurrence of potentially life-threatening conditions, maternal near miss and maternal deaths associated with antepartum and intrapartum hemorrhage was evaluated. Sociodemographic and obstetric characteristics and the use of criteria for management of severe bleeding were also assessed in these women. The prevalence ratios with their respective 95% confidence intervals adjusted for the cluster effect of the design, and multiple logistic regression analysis were performed to identify factors independently associated with the occurrence of severe maternal outcome. Antepartum and intrapartum hemorrhage occurred in only 8% (767) of women experiencing any type of obstetric complication. However, it was responsible for 18.2% (140) of maternal near miss and 10% (14) of maternal death cases. On multivariate analysis, maternal age and previous cesarean section were shown to be independently associated with an increased risk of severe maternal outcome (near miss or death). Severe maternal outcome due to antepartum and intrapartum hemorrhage was highly prevalent among Brazilian women. Certain risk factors, maternal age and previous cesarean delivery in particular, were associated with the occurrence of bleeding.

Effects Of Therapeutic Approach On The Neonatal Evolution Of Very Low Birth Weight Infants With Patent Ductus Arteriosus.

To analyze the effects of treatment approach on the outcomes of newborns (birth weight [BW] < 1,000 g) with patent ductus arteriosus (PDA), from the Brazilian Neonatal Research Network (BNRN) on: death, bronchopulmonary dysplasia (BPD), severe intraventricular hemorrhage (IVH III/IV), retinopathy of prematurity requiring surgical (ROPsur), necrotizing enterocolitis requiring surgery (NECsur), and death/BPD. This was a multicentric, cohort study, retrospective data collection, including newborns (BW < 1000 g) with gestational age (GA) < 33 weeks and echocardiographic diagnosis of PDA, from 16 neonatal units of the BNRN from January 1, 2010 to Dec 31, 2011. Newborns who died or were transferred until the third day of life, and those with presence of congenital malformation or infection were excluded. Groups: G1 - conservative approach (without treatment), G2 - pharmacologic (indomethacin or ibuprofen), G3 - surgical ligation (independent of previous treatment). Factors analyzed: antenatal corticosteroid, cesarean section, BW, GA, 5 min. Apgar score < 4, male gender, Score for Neonatal Acute Physiology Perinatal Extension (SNAPPE II), respiratory distress syndrome (RDS), late sepsis (LS), mechanical ventilation (MV), surfactant (< 2 h of life), and time of MV. death, O2 dependence at 36 weeks (BPD36wks), IVH III/IV, ROPsur, NECsur, and death/BPD36wks. Student's t-test, chi-squared test, or Fisher's exact test; Odds ratio (95% CI); logistic binary regression and backward stepwise multiple regression. Software: MedCalc (Medical Calculator) software, version 12.1.4.0. p-values < 0.05 were considered statistically significant. 1,097 newborns were selected and 494 newborns were included: G1 - 187 (37.8%), G2 - 205 (41.5%), and G3 - 102 (20.6%). The highest mortality was observed in G1 (51.3%) and the lowest in G3 (14.7%). The highest frequencies of BPD36wks (70.6%) and ROPsur were observed in G3 (23.5%). The lowest occurrence of death/BPD36wks occurred in G2 (58.0%). Pharmacological (OR 0.29; 95% CI: 0.14-0.62) and conservative (OR 0.34; 95% CI: 0.14-0.79) treatments were protective for the outcome death/BPD36wks. The conservative approach of PDA was associated to high mortality, the surgical approach to the occurrence of BPD36wks and ROPsur, and the pharmacological treatment was protective for the outcome death/BPD36wks.

Construction Of A Manual Of Work Processes And Techniques From Centro De Dispensação De Medicamentos De Alto Custo (cedmac), Hospital De Clínicas, Unicamp.

The Centers for High Cost Medication (Centros de Medicação de Alto Custo, CEDMAC), Health Department, São Paulo were instituted by project in partnership with the Clinical Hospital of the Faculty of Medicine, USP, sponsored by the Foundation for Research Support of the State of São Paulo (Fundação de Amparo à Pesquisa do Estado de São Paulo, FAPESP) aimed at the formation of a statewide network for comprehensive care of patients referred for use of immunobiological agents in rheumatological diseases. The CEDMAC of Hospital de Clínicas, Universidade Estadual de Campinas (HC-Unicamp), implemented by the Division of Rheumatology, Faculty of Medical Sciences, identified the need for standardization of the multidisciplinary team conducts, in face of the specificity of care conducts, verifying the importance of describing, in manual format, their operational and technical processes. The aim of this study is to present the methodology applied to the elaboration of the CEDMAC/HC-Unicamp Manual as an institutional tool, with the aim of offering the best assistance and administrative quality. In the methodology for preparing the manuals at HC-Unicamp since 2008, the premise was to obtain a document that is participatory, multidisciplinary, focused on work processes integrated with institutional rules, with objective and didactic descriptions, in a standardized format and with electronic dissemination. The CEDMAC/HC-Unicamp Manual was elaborated in 10 months, with involvement of the entire multidisciplinary team, with 19 chapters on work processes and techniques, in addition to those concerning the organizational structure and its annexes. Published in the electronic portal of HC Manuals in July 2012 as an e-Book (ISBN 978-85-63274-17-5), the manual has been a valuable instrument in guiding professionals in healthcare, teaching and research activities.

Hypothermia And Early Neonatal Mortality In Preterm Infants.

To evaluate intervention practices associated with hypothermia at both 5 minutes after birth and at neonatal intensive care unit (NICU) admission and to determine whether hypothermia at NICU admission is associated with early neonatal death in preterm infants. This prospective cohort included 1764 inborn neonates of 22-33 weeks without malformations admitted to 9 university NICUs from August 2010 through April 2012. All centers followed neonatal International Liaison Committee on Resuscitation recommendations for the stabilization and resuscitation in the delivery room (DR). Variables associated with hypothermia (axillary temperature <36.0 °C) 5 minutes after birth and at NICU admission, as well as those associated with early death, were analyzed by logistic regression. Hypothermia 5 minutes after birth and at NICU admission was noted in 44% and 51%, respectively, with 6% of early neonatal deaths. Adjusted for confounding variables, practices associated with hypothermia at 5 minutes after birth were DR temperature <25 °C (OR 2.13, 95% CI 1.67-2.28), maternal temperature at delivery <36.0 °C (OR 1.93, 95% CI 1.49-2.51), and use of plastic bag/wrap (OR 0.53, 95% CI 0.40-0.70). The variables associated with hypothermia at NICU admission were DR temperature <25 °C (OR 1.44, 95% CI 1.10-1.88), respiratory support with cold air in the DR (OR 1.40, 95% CI 1.03-1.88) and during transport to NICU (OR 1.51, 95% CI 1.08-2.13), and cap use (OR 0.55, 95% CI 0.39-0.78). Hypothermia at NICU admission increased the chance of early neonatal death by 1.64-fold (95% CI 1.03-2.61). Simple interventions, such as maintaining DR temperature >25 °C, reducing maternal hypothermia prior to delivery, providing plastic bags/wraps and caps for the newly born infants, and using warm resuscitation gases, may decrease hypothermia at NICU admission and improve early neonatal survival.

Chasing Cardiac Physiology And Pathology Down The Camkii Cascade.

Calcium dynamics is central in cardiac physiology, as the key event leading to the excitation-contraction coupling (ECC) and relaxation processes. The primary function of Ca(2+) in the heart is the control of mechanical activity developed by the myofibril contractile apparatus. This key role of Ca(2+) signaling explains the subtle and critical control of important events of ECC and relaxation, such Ca(2+) influx and SR Ca(2+) release and uptake. The multifunctional Ca(2+)-calmodulin-dependent protein kinase II (CaMKII) is a signaling molecule that regulates a diverse array of proteins involved not only in ECC and relaxation, but also in cell death, transcriptional activation of hypertrophy, inflammation and arrhythmias. CaMKII activity is triggered by an increase in intracellular Ca(2+) levels. This activity can be sustained, creating molecular memory after the decline in Ca(2+) concentration, by autophosphorylation of the enzyme, as well as by oxidation, glycosylation and nitrosylation at different sites of the regulatory domain of the kinase. CaMKII activity is enhanced in several cardiac diseases, altering the signaling pathways by which CaMKII regulates the different fundamental proteins involved in functional and transcriptional cardiac processes. Dysregulation of these pathways constitutes a central mechanism of various cardiac disease phenomena, like apoptosis and necrosis during ischemia/reperfusion injury, digitalis exposure, post-acidosis and heart failure arrhythmias, or cardiac hypertrophy. Here we summarize significant aspects of the molecular physiology of CaMKII and provide a conceptual framework for understanding the role of the CaMKII cascade on Ca(2+) regulation and dysregulation in cardiac health and disease.

Health-related And Socio-demographic Factors Associated With Frailty In The Elderly: A Systematic Literature Review.

Frailty is a syndrome that leads to practical harm in the lives of elders, since it is related to increased risk of dependency, falls, hospitalization, institutionalization, and death. The objective of this systematic review was to identify the socio-demographic, psycho-behavioral, health-related, nutritional, and lifestyle factors associated with frailty in the elderly. A total of 4,183 studies published from 2001 to 2013 were detected in the databases, and 182 complete articles were selected. After a comprehensive reading and application of selection criteria, 35 eligible articles remained for analysis. The main factors associated with frailty were: age, female gender, black race/color, schooling, income, cardiovascular diseases, number of comorbidities/diseases, functional incapacity, poor self-rated health, depressive symptoms, cognitive function, body mass index, smoking, and alcohol use. Knowledge of the complexity of determinants of frailty can assist the formulation of measures for prevention and early intervention, thereby contributing to better quality of life for the elderly.

Leaf-, Panel- And Latex-expressed Sequenced Tags From The Rubber Tree (hevea Brasiliensis) Under Cold-stressed And Suboptimal Growing Conditions: The Development Of Gene-targeted Functional Markers For Stress Response.

Hevea brasiliensis is a native species of the Amazon Basin of South America and the primary source of natural rubber worldwide. Due to the occurrence of South American Leaf Blight disease in this area, rubber plantations have been extended to suboptimal regions. Rubber tree breeding is time-consuming and expensive, but molecular markers can serve as a tool for early evaluation, thus reducing time and costs. In this work, we constructed six different cDNA libraries with the aim of developing gene-targeted molecular markers for the rubber tree. A total of 8,263 reads were assembled, generating 5,025 unigenes that were analyzed; 912 expressed sequence tags (ESTs) represented new transcripts, and two sequences were highly up-regulated by cold stress. These unigenes were scanned for microsatellite (SSR) regions and single nucleotide polymorphisms (SNPs). In total, 169 novel EST-SSR markers were developed; 138 loci were polymorphic in the rubber tree, and 98 % presented transferability to six other Hevea species. Locus duplication was observed in H. brasiliensis and other species. Additionally, 43 SNP markers in 13 sequences that showed similarity to proteins involved in stress response, latex biosynthesis and developmental processes were characterized. cDNA libraries are a rich source of SSR and SNP markers and enable the identification of new transcripts. The new markers developed here will be a valuable resource for linkage mapping, QTL identification and other studies in the rubber tree and can also be used to evaluate the genetic variability of other Hevea species, which are valuable assets in rubber tree breeding.

Myocardial Extracellular Volume Expansion And The Risk Of Recurrent Atrial Fibrillation After Pulmonary Vein Isolation.

This study tested whether myocardial extracellular volume (ECV) is increased in patients with hypertension and atrial fibrillation (AF) undergoing pulmonary vein isolation and whether there is an association between ECV and post-procedural recurrence of AF. Hypertension is associated with myocardial fibrosis, an increase in ECV, and AF. Data linking these findings are limited. T1 measurements pre-contrast and post-contrast in a cardiac magnetic resonance (CMR) study provide a method for quantification of ECV. Consecutive patients with hypertension and recurrent AF referred for pulmonary vein isolation underwent a contrast CMR study with measurement of ECV and were followed up prospectively for a median of 18 months. The endpoint of interest was late recurrence of AF. Patients had elevated left ventricular (LV) volumes, LV mass, left atrial volumes, and increased ECV (patients with AF, 0.34 ± 0.03; healthy control patients, 0.29 ± 0.03; p < 0.001). There were positive associations between ECV and left atrial volume (r = 0.46, p < 0.01) and LV mass and a negative association between ECV and diastolic function (early mitral annular relaxation [E'], r = -0.55, p < 0.001). In the best overall multivariable model, ECV was the strongest predictor of the primary outcome of recurrent AF (hazard ratio: 1.29; 95% confidence interval: 1.15 to 1.44; p < 0.0001) and the secondary composite outcome of recurrent AF, heart failure admission, and death (hazard ratio: 1.35; 95% confidence interval: 1.21 to 1.51; p < 0.0001). Each 10% increase in ECV was associated with a 29% increased risk of recurrent AF. In patients with AF and hypertension, expansion of ECV is associated with diastolic function and left atrial remodeling and is a strong independent predictor of recurrent AF post-pulmonary vein isolation.

Oropouche Virus Infection And Pathogenesis Is Restricted By Mavs, Irf-3, Irf-7, And Type I Ifn Signaling Pathways In Non-myeloid Cells.

Oropouche virus (OROV) is a member of the Orthobunyavirus genus in the Bunyaviridae family and a prominent cause of insect-transmitted viral disease in Central and South America. Despite its clinical relevance, little is known about OROV pathogenesis. To define the host defense pathways that control OROV infection and disease, we evaluated OROV pathogenesis and immune responses in primary cells and mice that were deficient in the RIG-I-like receptor signaling pathway (MDA5, RIG-I, or MAVS), downstream regulatory transcription factors (IRF-3 or IRF-7), IFN-β, or the receptor for type I IFN signaling (IFNAR). OROV replicated to higher levels in primary fibroblasts and dendritic cells lacking MAVS signaling, the transcription factors IRF-3 and IRF-7, or IFNAR. In mice, deletion of IFNAR, MAVS, or IRF-3 and IRF-7 resulted in uncontrolled OROV replication, hypercytokinemia, extensive liver damage, and death whereas wild-type (WT) congenic animals failed to develop disease. Unexpectedly, mice with a selective deletion of IFNAR on myeloid cells (CD11c Cre(+) Ifnar(f/f) or LysM Cre(+) Ifnar(f/f)) did not sustain enhanced disease with OROV or La Crosse virus, a closely related encephalitic orthobunyavirus. In bone marrow chimera studies, recipient irradiated Ifnar(-/-) mice reconstituted with WT hematopoietic cells sustained high levels of OROV replication and liver damage, whereas WT mice reconstituted with Ifnar(-/-) bone marrow were resistant to disease. Collectively, these results establish a dominant protective role for MAVS, IRF-3 and IRF-7, and IFNAR in restricting OROV virus infection and tissue injury, and suggest that IFN signaling in non-myeloid cells contributes to the host defense against orthobunyaviruses. Oropouche virus (OROV) is an emerging arthropod-transmitted orthobunyavirus that causes episodic outbreaks of a debilitating febrile illness in humans in countries of South and Central America. The continued expansion of the range and number of its arthropod vectors increases the likelihood that OROV will spread into new regions. At present, the pathogenesis of OROV in humans or other vertebrate animals remains poorly understood. To define cellular mechanisms of control of OROV infection, we performed infection studies in a series of primary cells and mice that were deficient in key innate immune genes involved in pathogen recognition and control. Our results establish that a MAVS-dependent type I IFN signaling pathway has a dominant role in restricting OROV infection and pathogenesis in vivo.

Reduction Of Oxidative Damage And Inflammatory Response In The Diaphragm Muscle Of Mdx Mice Using Iron Chelator Deferoxamine.

Oxidative stress and inflammatory processes strongly contribute to pathogenesis in Duchenne muscular dystrophy (DMD). Based on evidence that excess iron may increase oxidative stress and contribute to the inflammatory response, we investigated whether deferoxamine (DFX), a potent iron chelating agent, reduces oxidative stress and inflammation in the diaphragm (DIA) muscle of mdx mice (an experimental model of DMD). Fourteen-day-old mdx mice received daily intraperitoneal injections of DFX at a dose of 150 mg/kg body weight, diluted in saline, for 14 days. C57BL/10 and control mdx mice received daily intraperitoneal injections of saline only, for 14 days. Grip strength was evaluated as a functional measure, and blood samples were collected for biochemical assessment of muscle fiber degeneration. In addition, the DIA muscle was removed and processed for histopathology and Western blotting analysis. In mdx mice, DFX reduced muscle damage and loss of muscle strength. DFX treatment also resulted in a significant reduction of dystrophic inflammatory processes, as indicated by decreases in the inflammatory area and in NF-κB levels. DFX significantly decreased oxidative damage, as shown by lower levels of 4-hydroxynonenal and a reduction in dihydroethidium staining in the DIA muscle of mdx mice. The results of the present study suggest that DFX may be useful in therapeutic strategies to ameliorate dystrophic muscle pathology, possibly via mechanisms involving oxidative and inflammatory pathways.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Torcidas organizadas e seus jovens torcedores : diversidades e normativas do torcer = Torcidas organizadas and their young supporters : diversities and normatives of supporting

Universidade Estadual de Campinas . Faculdade de Educação Física

Conteudo curricular para crianças de creche de dois a tres anos : teoria e pratica

Universidade Estadual de Campinas. Faculdade de Educação Física