5 resultados para non-specific colitis

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

80.00% 80.00%

Publicador:

Resumo:

Biofilm formation on reverse osmosis (RO) systems represents a drawback in the application of this technology by different industries, including oil refineries. In RO systems the feed water maybe a source of microbial contamination and thus contributes for the formation of biofilm and consequent biofouling. In this study the planktonic culturable bacterial community was characterized from a feed water of a RO system and their capacities were evaluated to form biofilm in vitro. Bacterial motility and biofilm control were also analysed using phages. As results, diverse Protobacteria, Actinobacteria and Bacteroidetes were identified. Alphaproteobacteria was the predominant group and Brevundimonas, Pseudomonas and Mycobacterium the most abundant genera. Among the 30 isolates, 11 showed at least one type of motility and 11 were classified as good biofilm formers. Additionally, the influence of non-specific bacteriophage in the bacterial biofilms formed in vitro was investigated by action of phages enzymes or phage infection. The vB_AspP-UFV1 (Podoviridae) interfered in biofilm formation of most tested bacteria and may represent a good alternative in biofilm control. These findings provide important information about the bacterial community from the feed water of a RO system that may be used for the development of strategies for biofilm prevention and control in such systems.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Three cases of probable neurobrucellosis are reported. The diagnosis was made on the basis of imunological tests. Two patients with a clinical picture of meningomyelitis showed a definitive clinical improvement under tetraciclin and streptomòcin therapy. The imunological reactions found in the record case were even more positive in the spinal fluid than in the blood. In the case 3 with a clinical presentation of cerebral hemorrage the hitopathological studies demonstrated non specific chronic leptomeningitis and local hemorrages in the caudate nucleus bilaterally. The diagnose and treatment of neurobrucellosis are discussed, stressing the importance of an early therapy.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Beta cell destruction in type 1 diabetes (TID) is associated with cellular oxidative stress and mitochondrial pathway of cell death. The aim of this study was to determine whether oxidative stress and mitochondrial dysfunction are present in T1D model (non-obese diabetic mouse, NOD) and if they are related to the stages of disease development. NOD mice were studied at three stages: non-diabetic, pre-diabetic, and diabetic and compared with age-matched Balb/c mice. Mitochondria respiration rates measured at phosphorylating and resting states in liver and soleus biopsies and in isolated liver mitochondria were similar in NOD and Balb/c mice at the three disease stages. However, NOD liver mitochondria were more susceptible to calcium-induced mitochondrial permeability transition as determined by cyclosporine-A-sensitive swelling and by decreased calcium retention capacity in all three stages of diabetes development. Mitochondria H2O2 production rate was higher in non-diabetic, but unaltered in pre-diabetic and diabetic NOD mice. The global cell reactive oxygen species (ROS), but not specific mitochondria ROS production, was significantly increased in NOD lymphomononuclear and stem cells in all disease stages. In addition, marked elevated rates of 2',7'-dichlorodihydrofluorescein (H2DCF) oxidation were observed in pancreatic islets from non-diabetic NOD mice. Using matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) and lipidomic approach, we identified oxidized lipid markers in NOD liver mitochondria for each disease stage, most of them being derivatives of diacylglycerols and phospholipids. These results suggest that the cellular oxidative stress precedes the establishment of diabetes and may be the cause of mitochondrial dysfunction that is involved in beta cell death.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Isatin, an indole alkaloid has been shown to have anti-microbial, anti-tumor and anti-inflammatory effects. Due to its findings, we evaluated whether this alkaloid would have any effect on TNBS-induced colitis. Animals (male Unib:WH rats, aged 8 weeks old) were induced colitis through a rectal administration of 2,4,6-trinitrobenzene sulphonic acid using a catheter inserted 8 cm into the rectum of the animals. The rats were divided into two major groups: non-colitic and colitic. The colitic group was sub-divided into 6 groups (10 animals per group): colitic non-treated, Isatin 3; 6; 12.5; 18.75 and 25 mg/kg. Our main results showed that the oral treatment with Isatin 6 and 25 mg/kg were capable of avoiding the increase in TNF-α, COX-2 and PGE₂ levels when compared to the colitic non-treated group. Interestingly, the same doses (6 and 25 mg/kg) were also capable of preventing the decrease in IL-10 levels comparing with the colitic non-treated group. The levels of MPO, (an indirect indicator of neutrophil presence), were also maintained lower than those of the colitic non-treated group. Isatin also prevented the decrease of SOD activity and increase of GSH-Px and GSH-Rd activity as well as the depletion of GSH levels. In conclusion, both pre-treatments (6 and 25 mg/kg) were capable of protecting the gut mucosa against the injury caused by TNBS, through the combination of antioxidant and anti-inflammatory properties, which, together, showed a protective activity of the indole alkaloid Isatin.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.