Comparação da associação de diferentes programas de atividade física aplicados no local de trabalho sobre o nível de atividade física e qualidade de vida de trabalhadores do setor administrativo de comunidade universitária

Universidade Estadual de Campinas . Faculdade de Educação Física

Ciclimo de velocidade : uma proposta de controle da preparação fisica especial

Universidade Estadual de Campinas . Faculdade de Educação Física

Qualidade de vida em epilepsia e percepção de controle de crises

The individual affective-cognitive evaluations are important factors that control the way he feels the disease impact in his life. Then, the perception of seizure control is a more important factor to evaluate Quality of Life (QoL) than the illness characteristics, such as the severity, type, sickening period and seizure frequency. This study searched for the relationship among the subjective variables (perception of seizure control) and the illness characteristics to evaluate QoL. The sample consisted of 60 individuals with chronic epilepsy, aging 18 to 70 (M=37.05; SD=11.25), chosen at randon from the ambulatory of epilepsy - HC/UNICAMP, by the Questionnaire 65. The illness characteristics were not significant, except the seizures frequency, when associated to the impairment in QoL among controlled seizures and seizures with frequency higher than 10 per month (p=0.021). The perception of control was significantly associated to QoL (p=0.005).

Sistema de sincronismo entre a colhedora de cana-de-açúcar e o veículo de transbordo

One of the problems found in mechanical harvest of sugar cane is the lack of synchronism between the harvest machine and the infield wagon, causing crop losses as well as operational capacity. The objective of the present research was to design a system capable of helping to synchronize the sugar cane harvest machine with the wagon. The communication between tractor and harvest machine is wireless. Two ultrasound sensors coupled to the elevator and a microprocessor manage such information, generating a correct synchronization among the machines. The system was tested in laboratory and on field performing its function adequately, maintaining the two machines in synchronization, indicating and alerting the operators their relative positions. The developed system reduced the sugar cane lost in 60 kg ha-1 comparing to the harvest with the system turned off.

Análise de custo-efetividade de métodos preventivos para superfície oclusal de acordo com o risco de cárie: resultados de um ensaio clínico controlado

This study presents the results of a cost-effectiveness analysis in a controlled clinical trial on the effectiveness of a modified glass ionomer resin sealant ( Vitremer, 3M ESPE) and the application of fluoride varnish (Duraphat, Colgate) on occlusal surfaces of first permanent molars in children 6-8 years of age (N = 268), according to caries risk (high versus low). Children were examined semiannually by the same calibrated dentist for 24 months after allocation in six groups: high and low risk controls (oral health education every three months); high and low risk with varnish (oral health education every three months + varnish biannually); and high and low risk with sealant (oral health education every three months + a single application of sealant). Economic analysis showed that sealing permanent first molars of high-risk schoolchildren showed a C/E ratio of US$ 119.80 per saved occlusal surface and an incremental C/E ratio of US$ 108.36 per additional saved occlusal surface. The study concluded that sealing permanent first molars of high-risk schoolchildren was the most cost-effective intervention.

Seed dispersal of Solanum thomasiifolium Sendtner (Solanaceae) in the Linhares Forest, Espírito Santo state, Brazil

The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of nativo vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous), and one species of lizard (Tropidurus torquatus) fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds), 19% (crab-eating fox) and 4% (lizards). Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control), bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.

Análise bayesiana do modelo de herança monogênica no melhoramento vegetal: um exemplo com abobrinha

A common breeding strategy is to carry out basic studies to investigate the hypothesis of a single gene controlling the trait (major gene) with or without polygenes of minor effect. In this study we used Bayesian inference to fit genetic additive-dominance models of inheritance to plant breeding experiments with multiple generations. Normal densities with different means, according to the major gene genotype, were considered in a linear model in which the design matrix of the genetic effects had unknown coefficients (which were estimated in individual basis). An actual data set from an inheritance study of partenocarpy in zucchini (Cucurbita pepo L.) was used for illustration. Model fitting included posterior probabilities for all individual genotypes. Analysis agrees with results in the literature but this approach was far more efficient than previous alternatives assuming that design matrix was known for the generations. Partenocarpy in zucchini is controlled by a major gene with important additive effect and partial dominance.

Atributos mecânicos e erosão por salpicamento em amostras de latossolo vermelho-amarelo sob efeito de vinhaça

The objective of this study was to quantify the effect of plonk on compressive behavior and mechanical attributes such as consistency, optimum moisture for compaction and maximum density of a Red-Yellow Latosol (Oxisol) to evaluate the effect of plonk and compaction state in splashed particles, from Lavras (MG) region. The plonk was obtained from an artisanal sugarcane brandy alembic. Undisturbed and disturbed soil samples were collected at 0 to 3 cm and 60 to 63 cm depths. Disturbed soil samples were used for soil characterization, determination of consistence limits and Normal Proctor essay after material incubation with plonk. Undisturbed soil samples were saturated with plonk or distilled water (control) during 48 hours for testing the compressibility and resistance to splash by using simulated rainfall. The plonk altered the consistence limits of studied layers. For the 0-3 cm layer, the plonk reduced the friable range, and for the 60-63 cm layer the effect was in the opposite direction. For both layers, the plonk increased Dmax and decreased Uoptimum. Regardless of the plonk treatment, both layers presented the same load support capacity. The compaction degree of samples influenced the splash erosion. The increase of the applied pressure over the samples resulted in increase of splash material quantity. At the 60-63 cm layer, the plonk treatment reduced the splash material quantity by increasing the applied pressure, mainly when the samples were at field capacity.

Medo, ansiedade e controle relacionados ao tratamento odontológico

The aim of this study was to test fear, anxiety and control related to dental treatment. The subjects were 364 children with ages between 7 and 13 years. Three questionnaires with multiple choice questions were applied in groups of 10 children. The first instrument was the 15-item dental subscale from the Children’s Fear Survey Schedule9. The subjects rated their level of fear on a 5-point scale. The second survey instrument was the 20-item subscale from the State Trait Anxiety Inventory for Children16. This measure was used to capture how anxious the child was, in general. The third instrument was the Child Dental Control Assessment19. It contained 20 items to assess perceived control and 20 items to assess desired control. The results of the survey indicated that dental fear and anxiety were slightly higher for females when compared with male subjects (P < 0.05). Older children (11 to 13 years old) obtained higher fear scores than younger ones (7 to 9 years old). Concerning perceived control, the results indicate that younger children perceive more control than older ones. For desired control, the results indicate that younger children reported higher percentages than older ones. In this study, patients who had undergone anesthesia during treatment revealed higher fear scores when compared with those who had not. Dental fear etiology seems to be related to a procedure that may involve pain or lack of control.

Rugosidade e pigmentação superficial de materiais ionoméricos

The aim of this study was to compare two methods of surface roughness analysis, perfilometry and spectrophotometry, applied to the surface of ionomeric materials (Chelon Fil, Vitremer and Dyract), submitted to different surface finishing treatments. For the perfilometric analysis, sixty specimens of each material were made and randomly separated into three experimental groups. The average surface roughness (Ra, mm) was measured on each specimen by a surface perfilometer (Mitutoyo Surftest 211). The spectrophotometric analysis consisted in quantifying the dye impregnated in the samples. The dyes used were 0.5% fuchsin and 0.5% erythrosin. Data were submitted to variance analysis (ANOVA) and t-Student test at a 0.05 significance level. There was no linear correlation between average roughness and superficial deposition of dye. Perfilometric analysis revealed that 12- and 30-bladed carbide burs caused the roughest surface of Chelon Fil, followed by Sof-Lex discs and mylar band. There were no significant differences between the specimens submitted to finishing and polishing with Sof-Lex discs and the control group (mylar band) for Vitremer, nevertheless, the highest Ra values were obtained when 12- and 30-bladed burs were used. For Dyract, there was no significant difference between the three treatments. The mean values of superficial deposition of dye for Chelon Fil, Vitremer and Dyract were: 1.7261, 1.4759, 1.3318, respectively. There were no significant differences between the restorative materials when different finishing and polishing systems were used.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Qualidade de vida de portadores de Diabetes Mellitus tipo II frente às oscilações no nível de atividade física, aspectos socioeconômicos e presença de comorbidades

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise cinemática tridimensional do salto em distância de atletas de alto nível em competição

Universidade Estadual de Campinas . Faculdade de Educação Física

Adaptação do handebol para a prática em cadeira de rodas

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeitos de diferentes protocolos de treinamento físico sobre o controle autonômico e cardiorrespiratório em homens de meia-idade

Universidade Estadual de Campinas . Faculdade de Educação Física