Relationship Between Orofacial Function, Dentofacial Morphology, And Bite Force In Young Subjects.

The aim was to evaluate the relationship between orofacial function, dentofacial morphology, and bite force in young subjects. Three hundred and sixteen subjects were divided according to dentition stage (early, intermediate, and late mixed and permanent dentition). Orofacial function was screened using the Nordic Orofacial Test-Screening (NOT-S). Orthodontic treatment need, bite force, lateral and frontal craniofacial dimensions and presence of sleep bruxism were also assessed. The results were submitted to descriptive statistics, normality and correlation tests, analysis of variance, and multiple linear regression to test the relationship between NOT-S scores and the studied independent variables. The variance of NOT-S scores between groups was not significant. The evaluation of the variables that significantly contributed to NOT-S scores variation showed that age and presence of bruxism related to higher NOT-S total scores, while the increase in overbite measurement and presence of closed lip posture related to lower scores. Bite force did not show a significant relationship with scores of orofacial dysfunction. No significant correlations between craniofacial dimensions and NOT-S scores were observed. Age and sleep bruxism were related to higher NOT-S scores, while the increase in overbite measurement and closed lip posture contributed to lower scores of orofacial dysfunction.

Angiogenic Effects Of Cryosurgery With Liquid Nitrogen On The Normal Skin Of Rats, Through Morphometric Study.

Cryosurgery is an efficient therapeutic technique used to treat benign and malignant cutaneous diseases. The primary active mechanism of cryosurgery is related to vascular effects on treated tissue. After a cryosurgical procedure, exuberant granulation tissue is formed at the injection site, probably as a result of angiogenic stimulation of the cryogen and inflammatory response, particularly in endothelial cells. To evaluate the angiogenic effects of freezing, as part of the phenomenon of healing rat skin subjected to previous injury. Two incisions were made in each of the twenty rats, which were divided randomly into two groups of ten. After 3 days, cryosurgery with liquid nitrogen was performed in one of incisions. The rats' samples were then collected, cut and stained to conduct histopathological examination, to assess the local angiogenesis in differing moments and situations. It was possible to demonstrate that cryosurgery, in spite of promoting cell death and accentuated local inflammation soon after its application, induces quicker cell proliferation in the affected tissue and maintenance of this rate in a second phase, than in tissue healing without this procedure. These findings, together with the knowledge that there is a direct relationship between mononuclear cells and neovascularization (the development of a rich system of new vessels in injury caused by cold), suggest that cryosurgery possesses angiogenic stimulus, even though complete healing takes longer to occur. The significance level for statistical tests was 5% (p<0,05).

Relationship Between Lower-limb Muscle Strength And Functional Independence Among Elderly People According To Frailty Criteria: A Cross-sectional Study.

Muscle strength and functional independence are considered to be determinants of frailty levels among elderly people. The aim here was to compare lower-limb muscle strength (LLMS) with functional independence in relation to sex, age and number of frailty criteria, and to ascertain the influence of these variables on elderly outpatients' independence. Quantitative cross-sectional study, in a tertiary hospital. The study was conducted on 150 elderly outpatients of both sexes who were in a cognitive condition allowing oral communication, between October 2005 and October 2007. The following instruments were used: five-times sit-to-stand test (FTSST), Functional Independence Measurement (FIM) and Lawton's Instrumental Activities of Daily Living Scale (IADL). Descriptive, comparative, multivariate, univariate and Cronbach alpha analyses were performed. The mean time taken in the FTSST was 21.7 seconds; the mean score for FIM was 82.2 and for IADL was 21.2; 44.7% of the subjects presented 1-2 frailty criteria and 55.3% > 3 criteria. There was a significant association between LLMS and functional independence in relation to the number of frailty criteria, without homogeneity regarding sex and age. Functional independence showed significant influence from sex and LLMS. Elderly individuals with 1 or 2 frailty criteria presented greater independence in all FTSST scores. The subjects with higher LLMS presented better functional independence.

Fracture Of Distal Humerus: Mipo Technique With Visualization Of The Radial Nerve.

To evaluate the outcomes in patients treated for humerus distal third fractures with MIPO technique and visualization of the radial nerve by an accessory approach, in those without radial palsy before surgery. The patients were treated with MIPO technique. The visualization and isolation of the radial nerve was done by an approach between the brachialis and the brachiorradialis, with an oblique incision, in the lateral side of the arm. MEPS was used to evaluate the elbow function. Seven patients were evaluated with a mean age of 29.8 years old. The average follow up was 29.85 months. The radial neuropraxis after surgery occurred in three patients. The sensorial recovery occurred after 3.16 months on average and also of the motor function, after 5.33 months on average, in all patients. We achieved fracture consolidation in all patients (M=4.22 months). The averages for flexion-extension and prono-supination were 112.85° and 145°, respectively. The MEPS average score was 86.42. There was no case of infection. This approach allowed excluding a radial nerve interposition on site of the fracture and/or under the plate, showing a high level of consolidation of the fracture and a good evolution of the range of movement of the elbow. Level of Evidence IV, Case Series.

Relationship Between Aerobic And Anaerobic Parameters From 3-minute All-out Tethered Swimming And 400-m Maximal Front Crawl Effort.

The main aim of this investigation was to verify the relationship of the variables measured during a 3-minute all-out test with aerobic (i.e., peak oxygen uptake [(Equation is included in full-text article.)] and intensity corresponding to the lactate minimum [LMI]) and anaerobic parameters (i.e., anaerobic work) measured during a 400-m maximal performance. To measure force continually and to avoid the possible influences caused by turns, the 3-minute all-out effort was performed in tethered swimming. Thirty swimmers performed the following tests: (a) a 3-minute all-out tethered swimming test to determine the final force (equivalent to critical force: CF3-MIN) and the work performed above CF3-MIN (W'3-MIN), (b) a LMI protocol to determine the LMI during front crawl swimming, and (c) a 400-m maximal test to determine the (Equation is included in full-text article.)and total anaerobic contribution (WANA). Correlations between the variables were tested using the Pearson's correlation test (p ≤ 0.05). CF3-MIN (73.9 ± 13.2 N) presented a high correlation with the LMI (1.33 ± 0.08 m·s; p = 0.01) and (Equation is included in full-text article.)(4.5 ± 1.2 L·min; p = 0.01). However, the W'3-MIN (1,943.2 ± 719.2 N·s) was only moderately correlated with LMI (p = 0.02) and (Equation is included in full-text article.)(p = 0.01). In summary, CF3-MIN determined during the 3-minute all-out effort is associated with oxidative metabolism and can be used to estimate the aerobic capacity of swimmers. In contrast, the anaerobic component of this model (W'3-MIN) is not correlated with WANA.

In Vitro Effects Of Hydrogen Peroxide Combined With Different Activators For The In-office Bleaching Technique On Enamel.

Abstract Objective. The aim of this study was to evaluate the alteration of human enamel bleached with high concentrations of hydrogen peroxide associated with different activators. Materials and methods. Fifty enamel/dentin blocks (4 × 4 mm) were obtained from human third molars and randomized divided according to the bleaching procedure (n = 10): G1 = 35% hydrogen peroxide (HP - Whiteness HP Maxx); G2 = HP + Halogen lamp (HL); G3 = HP + 7% sodium bicarbonate (SB); G4 = HP + 20% sodium hydroxide (SH); and G5 = 38% hydrogen peroxide (OXB - Opalescence Xtra Boost). The bleaching treatments were performed in three sessions with a 7-day interval between them. The enamel content, before (baseline) and after bleaching, was determined using an FT-Raman spectrometer and was based on the concentration of phosphate, carbonate, and organic matrix. Statistical analysis was performed using two-way ANOVA for repeated measures and Tukey's test. Results. The results showed no significant differences between time of analysis (p = 0.5175) for most treatments and peak areas analyzed; and among bleaching treatments (p = 0.4184). The comparisons during and after bleaching revealed a significant difference in the HP group for the peak areas of carbonate and organic matrix, and for the organic matrix in OXB and HP+SH groups. Tukey's analysis determined that the difference, peak areas, and the interaction among treatment, time and peak was statistically significant (p < 0.05). Conclusion. The association of activators with hydrogen peroxide was effective in the alteration of enamel, mainly with regards to the organic matrix.

Preservation Of The External Jugular Vein In Bilateral Radical Neck Dissections: Technique In Two Cases And Review Of The Literature.

Context. The possibility of cephalic venous hypertension with the resultant facial edema and elevated cerebrospinal fluid pressure continues to challenge head and neck surgeons who perform bilateral radical neck dissections during simultaneous or staged procedures. Case Report. The staged procedure in patients who require bilateral neck dissections allows collateral venous drainage to develop, mainly through the internal and external vertebral plexuses, thereby minimizing the risks of deleterious consequences. Nevertheless, this procedure has disadvantages, such as a delay in definitive therapy, the need for a second hospitalization and anesthesia, and the risk of cutting lymphatic vessels and spreading viable cancer cells. In this paper, we discuss the rationale and feasibility of preserving the external jugular vein. Considering the limited number of similar reports in the literature, two cases in which this procedure was accomplished are described. The relevant anatomy and technique are reviewed and the patients' outcomes are discussed. Conclusion. Preservation of the EJV during bilateral neck dissections is technically feasible, fast, and safe, with clinically and radiologically demonstrated patency.

Towards A Deeper Understanding Of Structural Biomass Recalcitrance Using Phase-contrast Tomography.

The development of technological routes to convert lignocellulosic biomass to liquid fuels requires an in-depth understanding of the cell wall architecture of substrates. Essential pretreatment processes are conducted to reduce biomass recalcitrance and usually increase the reactive surface area. Quantitative three-dimensional information about both bulk and surface structural features of substrates needs to be obtained to expand our knowledge of substrates. In this work, phase-contrast tomography (PCT) was used to gather information about the structure of a model lignocellulosic biomass (piassava fibers). The three-dimensional cellular organization of piassava fibers was characterized by PCT using synchrotron radiation. This technique enabled important physical features that describe the substrate piassava fibers to be visualized and quantified. The external surface area of a fiber and internal surface area of the pores in a fiber could be determined separately. More than 96% of the overall surface area available to enzymes was in the bulk substrate. The pore surface area and length exhibited a positive linear relationship, where the slope of this relationship depended on the plant tissue. We demonstrated that PCT is a powerful tool for the three-dimensional characterization of the cell wall features related to biomass recalcitrance. Original and relevant quantitative information about the structural features of the analyzed material were obtained. The data obtained by PCT can be used to improve processing routes to efficiently convert biomass feedstock into sugars.

High Prevalence Of Insulin Resistance Assessed By The Glucose Clamp Technique In Hormonal And Non-hormonal Contraceptive Users.

Objective To assess the prevalence of insulin resistance (IR) and associated factors in contraceptive users. Methods A total of 47 women 18 to 40 years of age with a body mass index (kg/m(2)) < 30, fasting glucose levels < 100 mg/dl and 2-hour glucose level < 140 mg/dl after a 75-g oral glucose load were submitted to a hyperinsulinemic-euglycemic clamp. The women were distributed in tertiles regarding M-values. The analysed variables were use of combined hormonal/non-hormonal contraception, duration of use, body composition, lipid profile, glucose levels and blood pressure. Results IR was detected in 19% of the participants. The women with low M-values presented significantly higher body fat mass, waist-to-hip ratio, fasting insulin, HOMA-IR and were nulligravida, showed > 1 year of contraceptive use and higher triglyceride levels. IR was more frequent among combined oral contraceptive users, however no association was observed after regression analysis. Conclusions The prevalence of IR was high among healthy women attending a family planning clinic independent of the contraceptive method used with possible long-term negative consequences regarding their metabolic and cardiovascular health. Although an association between hormonal contraception and IR could not be found this needs further research. Family planning professionals should be proactive counselling healthy women about the importance of healthy habits.

The relationship between physical aspects of quality of life and extreme levels of regular physical activity in adults

This study aimed to check for any significant differences in perceived quality of life, specifically aspects of a physical nature, among volunteers who are more physically active and those less physically active in a university community. The sample consisted of 1,966 volunteers in a university community in Brazil. To assess physical activity levels, volunteers responded to the International Physical Activity Questionnaire (IPAQ), and to analyse the perception of quality of life they responded to WHOQOL-bref, which is classified into three groups according to level of physical activity, taking into account the metabolic equivalent index (MET) over a full week. For comparison, consideration was given to the first and third tertiles, respectively, namely groups of more and less active students. The results indicated that individuals who engaged in more physical activity had a more positive perception of quality of life compared to those who were less active in physical aspects related to the ability to work, energy for day-to-day activities and locomotion.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

A dança na formação docente em educação física

Universidade Estadual de Campinas . Faculdade de Educação Física

Tua imensa torcida e bem feliz... da relação torcedor com o clube

Universidade Estadual de Campinas . Faculdade de Educação Física

O papel da propriocepção no desenvolvimento da força muscular e da flexibilidade

Universidade Estadual de Campinas . Faculdade de Educação Física

O clown visitador no tratamento de crianças hospitalizadas

Universidade Estadual de Campinas. Faculdade de Educação Física