Yellowing And Bleaching Of Grey Hair Caused By Photo And Thermal Degradation.

Yellowing is an undesirable phenomenon that is common in people with white and grey hair. Because white hair has no melanin, the pigment responsible for hair colour, the effects of photodegradation are more visible in this type of hair. The origin of yellowing and its relation to photodegradation processes are not properly established, and many questions remain open in this field. In this work, the photodegradation of grey hair was investigated as a function of the wavelength of incident radiation, and its ultrastructure was determined, always comparing the results obtained for the white and black fibres present in grey hair with the results of white wool. The results presented herein indicate that the photobehaviour of grey hair irradiated with a mercury lamp or with solar radiation is dependent on the wavelength range of the incident radiation and on the initial shade of yellow in the sample. Two types of grey hair were used: (1) blended grey hair (more yellow) and (2) grey hair from a single-donor (less yellow). After exposure to a full-spectrum mercury lamp for 200 h, the blended white hair turned less yellow (the yellow-blue difference, Db(*) becomes negative, Db(*)=-6), whereas the white hair from the single-donor turned slightly yellower (Db(*)=2). In contrast, VIS+IR irradiation resulted in bleaching in both types of hair, whereas a thermal treatment (at 81 °C) caused yellowing of both types of hair, resulting in a Db(*)=3 for blended white hair and Db(*)=9 for single-donor hair. The identity of the yellow chromophores was investigated by UV-Vis spectroscopy. The results obtained with this technique were contradictory, however, and it was not possible to obtain a simple correlation between the sample shade of yellow and the absorption spectra. In addition, the results are discussed in terms of the morphology differences between the pigmented and non-pigmented parts of grey hair, the yellowing and bleaching effects of grey hair, and the occurrence of dark-follow reactions.

Interplay Between Cell Growth And Cell Cycle In Plants.

The growth of organs and whole plants depends on both cell growth and cell-cycle progression, but the interaction between both processes is poorly understood. In plants, the balance between growth and cell-cycle progression requires coordinated regulation of four different processes: macromolecular synthesis (cytoplasmic growth), turgor-driven cell-wall extension, mitotic cycle, and endocycle. Potential feedbacks between these processes include a cell-size checkpoint operating before DNA synthesis and a link between DNA contents and maximum cell size. In addition, key intercellular signals and growth regulatory genes appear to target at the same time cell-cycle and cell-growth functions. For example, auxin, gibberellin, and brassinosteroid all have parallel links to cell-cycle progression (through S-phase Cyclin D-CDK and the anaphase-promoting complex) and cell-wall functions (through cell-wall extensibility or microtubule dynamics). Another intercellular signal mediated by microtubule dynamics is the mechanical stress caused by growth of interconnected cells. Superimposed on developmental controls, sugar signalling through the TOR pathway has recently emerged as a central control point linking cytoplasmic growth, cell-cycle and cell-wall functions. Recent progress in quantitative imaging and computational modelling will facilitate analysis of the multiple interconnections between plant cell growth and cell cycle and ultimately will be required for the predictive manipulation of plant growth.

Screening The Life Cycle Of Schistosoma Mansoni Using High-resolution Mass Spectrometry.

Schistosomiasis is a common tropical disease caused by Schistosoma species Schistosomiasis' pathogenesis is known to vary according to the worms' strain. Moreover, high parasitical virulence is directly related to eggs release and granulomatous inflammation in the host's organs. This virulence might be influenced by different classes of molecules, such as lipids. Therefore, better understanding of the metabolic profile of these organisms is necessary, especially for an increased potential of unraveling strain virulence mechanisms and resistance to existing treatments. In this report, direct-infusion electrospray high-resolution mass spectrometry (ESI(+)-HRMS) along with the lipidomic platform were employed to rapidly characterize and differentiate two Brazilian S. mansoni strains (BH and SE) in three stages of their life cycle: eggs, miracidia and cercariae, with samples from experimental animals (Swiss/SPF mice). Furthermore, urine samples of the infected and uninfected mice were analyzed to assess the possibility of direct diagnosis. All samples were differentiated using multivariate data analysis, PCA, which helped electing markers from distinct lipid classes; phospholipids, diacylglycerols and triacylglycerols, for example, clearly presented different intensities in some stages and strains, as well as in urine samples. This indicates that biochemical characterization of S. mansoni may help narrowing-down the investigation of new therapeutic targets according to strain composition and aggressiveness of disease. Interestingly, lipid profile of infected mice urine varies when compared to control samples, indicating that direct diagnosis of schistosomiasis from urine may be feasible.

Polymorphisms Of Cell Cycle Control Genes Influence The Development Of Sporadic Medullary Thyroid Carcinoma.

The role of key cell cycle regulation genes such as, CDKN1B, CDKN2A, CDKN2B, and CDKN2C in sporadic medullary thyroid carcinoma (s-MTC) is still largely unknown. In order to evaluate the influence of inherited polymorphisms of these genes on the pathogenesis of s-MTC, we used TaqMan SNP genotyping to examine 45 s-MTC patients carefully matched with 98 controls. A multivariate logistic regression analysis demonstrated that CDKN1B and CDKN2A genes were related to s-MTC susceptibility. The rs2066827*GT+GG CDKN1B genotype was more frequent in s-MTC patients (62.22%) than in controls (40.21%), increasing the susceptibility to s-MTC (OR=2.47; 95% CI=1.048-5.833; P=0.038). By contrast, the rs11515*CG+GG of CDKN2A gene was more frequent in the controls (32.65%) than in patients (15.56%), reducing the risk for s-MTC (OR=0.174; 95% CI=0.048-0.627; P=0.0075). A stepwise regression analysis indicated that two genotypes together could explain 11% of the total s-MTC risk. In addition, a relationship was found between disease progression and the presence of alterations in the CDKN1A (rs1801270), CDKN2C (rs12885), and CDKN2B (rs1063192) genes. WT rs1801270 CDKN1A patients presented extrathyroidal tumor extension more frequently (92%) than polymorphic CDKN1A rs1801270 patients (50%; P=0.0376). Patients with the WT CDKN2C gene (rs12885) presented larger tumors (2.9±1.8 cm) than polymorphic patients (1.5±0.7 cm; P=0.0324). On the other hand, patients with the polymorphic CDKN2B gene (rs1063192) presented distant metastases (36.3%; P=0.0261). In summary, we demonstrated that CDKN1B and CDKN2A genes are associated with susceptibility, whereas the inherited genetic profile of CDKN1A, CDKN2B, and CDKN2C is associated with aggressive features of tumors. This study suggests that profiling cell cycle genes may help define the risk and characterize s-MTC aggressiveness.

Reference Values For High-density Lipoprotein Particle Size And Volume By Dynamic Light Scattering In A Brazilian Population Sample And Their Relationships With Metabolic Parameters.

Current data indicate that the size of high-density lipoprotein (HDL) may be considered an important marker for cardiovascular disease risk. We established reference values of mean HDL size and volume in an asymptomatic representative Brazilian population sample (n=590) and their associations with metabolic parameters by gender. Size and volume were determined in HDL isolated from plasma by polyethyleneglycol precipitation of apoB-containing lipoproteins and measured using the dynamic light scattering (DLS) technique. Although the gender and age distributions agreed with other studies, the mean HDL size reference value was slightly lower than in some other populations. Both HDL size and volume were influenced by gender and varied according to age. HDL size was associated with age and HDL-C (total population); non- white ethnicity and CETP inversely (females); HDL-C and PLTP mass (males). On the other hand, HDL volume was determined only by HDL-C (total population and in both genders) and by PLTP mass (males). The reference values for mean HDL size and volume using the DLS technique were established in an asymptomatic and representative Brazilian population sample, as well as their related metabolic factors. HDL-C was a major determinant of HDL size and volume, which were differently modulated in females and in males.

Human Mitochondrial Hsp70 (mortalin): Shedding Light On Atpase Activity, Interaction With Adenosine Nucleotides, Solution Structure And Domain Organization.

The human mitochondrial Hsp70, also called mortalin, is of considerable importance for mitochondria biogenesis and the correct functioning of the cell machinery. In the mitochondrial matrix, mortalin acts in the importing and folding process of nucleus-encoded proteins. The in vivo deregulation of mortalin expression and/or function has been correlated with age-related diseases and certain cancers due to its interaction with the p53 protein. In spite of its critical biological roles, structural and functional studies on mortalin are limited by its insoluble recombinant production. This study provides the first report of the production of folded and soluble recombinant mortalin when co-expressed with the human Hsp70-escort protein 1, but it is still likely prone to self-association. The monomeric fraction of mortalin presented a slightly elongated shape and basal ATPase activity that is higher than that of its cytoplasmic counterpart Hsp70-1A, suggesting that it was obtained in the functional state. Through small angle X-ray scattering, we assessed the low-resolution structural model of monomeric mortalin that is characterized by an elongated shape. This model adequately accommodated high resolution structures of Hsp70 domains indicating its quality. We also observed that mortalin interacts with adenosine nucleotides with high affinity. Thermally induced unfolding experiments indicated that mortalin is formed by at least two domains and that the transition is sensitive to the presence of adenosine nucleotides and that this process is dependent on the presence of Mg2+ ions. Interestingly, the thermal-induced unfolding assays of mortalin suggested the presence of an aggregation/association event, which was not observed for human Hsp70-1A, and this finding may explain its natural tendency for in vivo aggregation. Our study may contribute to the structural understanding of mortalin as well as to contribute for its recombinant production for antitumor compound screenings.

Influence Of Successive Light-activation On Degree Of Conversion And Knoop Hardness Of The First Layered Composite Increment.

To evaluate the influence of light-activation of second, third and fourth increments on degree of conversion (DC) and microhardness (KHN) of the top (T) and bottom (B) surface of the first increment. Forty samples (n = 5) were prepared. In groups 1-4, after each increment light-activation (multiple irradiation), T and B of the first increment were measured in DC and KHN. In groups 5-8, only the first increment was made (single irradiation) and measurements of DC and KHN were taken at 15 min intervals. The light-activation modes were (XL) 500 mW/cm(2) × 38 s (G1/G5); (S) 1000 mW/cm(2) × 19 s (G2/G6), (HP) 1400 mW/cm(2) × 14 s (G3/G7); (PE) 3200 mW/cm(2) × 6 s (G4/G8). Data for DC and KHN were analyzed separately by using PROC MIXED for repeated measures and Tukey-Kramer test (α = 0.05). For KHN, B showed lower values than T. PE resulted in lower values of KHN in B surface. For single and multiple irradiations, T and B of first measurement showed the lowest KHN and the fourth measurement showed the highest, with significant difference between them. For single irradiation, first and second increments presented similar KHN, different from the third and fourth increment, which did not differ between them. For multiple irradiations, the second light-activation resulted in KHN similar to first, third and fourth increments. For DC, except QTH, T presented higher DC than B. The light-activation of successive increments was not able to influence the KHN and DC of the first increment.

Germinação de esporos de Polypodium pleopeltifolium: resultados preliminares

Polypodium pleopeltifolium is an epiphytic fern which occurs in cerrado vegetation of the State of São Paulo, Brazil. The species is light sensitive for germination but some spores germinate in the absence of light. Short treatments at 40 or 5ºC and alternating temperatures did not increase the germination in dark conditions. Germination was not affected by IAA but it was reduced by GA3, CEPA and ABA. Red light (short treatments) promoted germination.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Proposição e avaliação de um método baseado em projeção de luz para reconstrução e análise da superfície do tronco durante a respiração

Universidade Estadual de Campinas . Faculdade de Educação Física

Sistema de análise de movimento para avaliação da postura vertical durante a corrida no teste de esforço máximo incremental

Universidade Estadual de Campinas . Faculdade de Educação Física