23 resultados para language for specific purposes testing

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Although benign epilepsy with centrotemporal spikes (BECTS) is an idiopathic, age-related epilepsy syndrome with favorable outcome, recent studies have shown impairment in specific neuropsychological tests. The objective of this study was to analyze the comorbidity between dyslexia and BECTS. Thirty-one patients with clinical and electroencephalographic diagnosis of BECTS (group A) and 31 paired children (group B) underwent a language and neuropsychological assessment performed with several standardized protocols. Our findings were categorized as: a) dyslexia; b) other difficulties; c) without difficulties. Our results were compared and statistically analyzed. Our data showed that dyslexia occurred in 19.4% and other difficulties in 74.2% of our patients. This was highly significant when compared with the control group (p<0.001). Phonological awareness, writing, reading, arithmetic, and memory tests showed a statistically significant difference when comparing both groups. Our findings show significant evidence of the occurrence of dyslexia in patients with BECTS.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To evaluate the microtensile bond strength (µTBS) of a fluoride-containing adhesive system submitted to a pH-cycling and storage time regimen for primary outcomes. As secondary outcomes the fluoride released amount was evaluated. Twelve dentin surfaces from sound third molar were divided into 2 groups according to adhesive systems: Clearfil SE Protect (PB) and Clearfil SE Bond (SE). Sticks obtained (1.0 mm2) from teeth were randomly divided into 3 subgroups according to storage regimen model: immediate (24h); 5-month deionized water (W); and pH-cycling model (C). All sticks were tested for µTBS in a universal testing machine. Fluoride concentration was obtained from 1-4 days and 30-day in W and 1-4 days in demineralization (DE)/remineralization (RE) solutions from C, using a fluoride-specific electrode. µTBS and fluoride released data were, respectively, submitted to ANOVA in a split plot design and Tukey, and Friedman' tests (a=0.05). There was no significant interaction between adhesive system and storage regimen for µTBS. W showed the lowest µTBS values. There was no significant difference between 24 h and C models for µTBS. There was no significant difference between adhesive systems. Failure mode was predominantly cohesive within composite for the 24 h and W, for the C group it was mixed for SE and cohesive within composite for PB adhesive system. Fluoride concentrations in the DE/RE solutions were less than 0.03125 ppm and not detected in W. In conclusion, the fluoride-containing adhesive system performed similarly to the regular one. Hydrolytic degradation is the main problem with both adhesive systems, regardless of fluoride contents.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aware of the diffusion capacity of bleaching in the dental tissues, many orthodontists are subjecting their patients to dental bleaching during orthodontic treatment for esthetic purposes or to anticipate the exchange of esthetic restorations after the orthodontic treatment. For this purpose specific products have been developed in pre-loaded whitening trays designed to fit over and around brackets and wires, with clinical efficacy proven. The objective of this study was to evaluate, through spectrophotometric reflectance, the effectiveness of dental bleaching under orthodontic bracket. Thirty-two bovine incisors crown blocks of 8 mm x 8 mm height lengths were used. Staining of tooth blocks with black tea was performed for six days. They were distributed randomly into 4 groups (1-home bleaching with bracket, 2- home bleaching without bracket, 3- office bleaching with bracket, 4 office bleaching without bracket). The color evaluation was performed (CIE L * a * b *) using color reflectance spectrophotometer. Metal brackets were bonded in groups 1 and 3. The groups 1 and 2 samples were subjected to the carbamide peroxide at 15%, 4 hours daily for 21 days. Groups 3 and 4 were subjected to 3 in-office bleaching treatment sessions, hydrogen peroxide 38%. After removal of the brackets, the second color evaluation was performed in tooth block, difference between the area under the bracket and around it, and after 7 days to verified color stability. Data analysis was performed using the paired t-test and two-way variance analysis and Tukey's. The home bleaching technique proved to be more effective compared to the office bleaching. There was a significant difference between the margin and center color values of the specimens that were subjected to bracket bonding. The bracket bond presence affected the effectiveness of both the home and office bleaching treatments. Key words:Tooth bleaching, spectrophotometry, orthodontics.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

There is an urgent need to make drug discovery cheaper and faster. This will enable the development of treatments for diseases currently neglected for economic reasons, such as tropical and orphan diseases, and generally increase the supply of new drugs. Here, we report the Robot Scientist 'Eve' designed to make drug discovery more economical. A Robot Scientist is a laboratory automation system that uses artificial intelligence (AI) techniques to discover scientific knowledge through cycles of experimentation. Eve integrates and automates library-screening, hit-confirmation, and lead generation through cycles of quantitative structure activity relationship learning and testing. Using econometric modelling we demonstrate that the use of AI to select compounds economically outperforms standard drug screening. For further efficiency Eve uses a standardized form of assay to compute Boolean functions of compound properties. These assays can be quickly and cheaply engineered using synthetic biology, enabling more targets to be assayed for a given budget. Eve has repositioned several drugs against specific targets in parasites that cause tropical diseases. One validated discovery is that the anti-cancer compound TNP-470 is a potent inhibitor of dihydrofolate reductase from the malaria-causing parasite Plasmodium vivax.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this paper we present a study of reading comprehension based on a contrastive argumentative-discursive approach. We examine the relationship between linguistic materiality and discursive processes, observing the connection between reading in a foreign language, writing production and textual memories in the mother tongue. In addition to an interest in practical language teaching and learning processes (in this case of Spanish and Portuguese), we investigate the question of politeness and the theoretical relationship between subjectivity, language, and textuality. The latter, being understood as the result of discourse regularities, is unique for each and every production, yet is also conditioned by plural discursive memories resulting from contradictory social relationships in a specific historical context (Foucault, 1986; Pêcheux, 1990). In the experiment presented here, we follow some of the procedures of the methodology applied in the European Galatea Project developed for the study of reading strategies in the inter-comprehension between Romance languages (Dabène, 1996). We use the procedure of simulation and the subjective projection of participants as well as the notion of discursive resonance in the analysis. The results, having to do with directness and indirectness in speech and the question of politeness in two typologically close languages, lead to the conclusion that the concept of politeness goes beyond a pragmatic strategy used to avoid conflicts to be approached as a marker of cultural identity constitution. The relevance of discursive awareness and its theoretical and practical consequences are then emphasized.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper reports some exemplary data related to a research project on the role of translation in foreign language teaching-learning. The data were collected through a questionnaire administered to 47 Brazilian ESL learners. Specifically, the points of the analysis are: how the translation process is conceived by the students; why and when the translation is used by the learners in classroom situations; mother tongue/foreign language relationships in this specific context, among other aspects. The findings reveal that translation, when used a mediating resource for foreign language teaching-learning, can promote target language management.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: To determine the association between language and number of citations of ophthalmology articles published in Brazilian journals. METHODS: This study was a systematic review. Original articles were identified by review of documents published at the two Brazilian ophthalmology journals indexed at Science Citation Index Expanded - SCIE [Arquivos Brasileiros de Oftalmologia (ABO) and Revista Brasileira de Oftalmologia (RBO)]. All document types (articles and reviews) listed at SCIE in English (English Group) or in Portuguese (Portuguese Group) from January 1, 2008 to December 31, 2009 were included, except: editorial materials; corrections; letters; and biographical items. The primary outcome was the number of citations through the end of second year after publication date. Subgroup analysis included likelihood of citation (cited at least once versus no citation), journal, and year of publication. RESULTS: The search at the web of science revealed 382 articles [107 (28%) in the English Group and 275 (72%) in the Portuguese Group]. Of those, 297 (77.7%) were published at the ABO and 85 (23.3%) at the RBO. The citation counts were statistically significantly higher (P<0.001) in the English Group (1.51 - SD 1.98 - range 0 to 11) compared with the Portuguese Group (0.57 - SD 1.06 - range 0 to 7). The likelihood citation was statistically significant higher (P<0.001) in the English Group (70/107 - 65.4%) compared with the Portuguese Group (89/275 - 32.7%). There were more articles published in English at the ABO (98/297 - 32.9%) than at the RBO (9/85 - 10.6%) [P<0.001]. There were no significant difference (P=0.967) at the proportion of articles published in English at the years 2008 (48/172 - 27.9%) and 2009 (59/210 - 28.1%). CONCLUSION: The number of citations of articles published in Portuguese at Brazilian ophthalmology journals is lower than the published in English. The results of this study suggest that the editorial boards should strongly encourage the authors to adopt English as the main language in their future articles.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física