9 resultados para journalism and death

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

To evaluate the occurrence of severe obstetric complications associated with antepartum and intrapartum hemorrhage among women from the Brazilian Network for Surveillance of Severe Maternal Morbidity. Multicenter cross-sectional study. Twenty-seven obstetric referral units in Brazil between July 2009 and June 2010. A total of 9555 women categorized as having obstetric complications. The occurrence of potentially life-threatening conditions, maternal near miss and maternal deaths associated with antepartum and intrapartum hemorrhage was evaluated. Sociodemographic and obstetric characteristics and the use of criteria for management of severe bleeding were also assessed in these women. The prevalence ratios with their respective 95% confidence intervals adjusted for the cluster effect of the design, and multiple logistic regression analysis were performed to identify factors independently associated with the occurrence of severe maternal outcome. Antepartum and intrapartum hemorrhage occurred in only 8% (767) of women experiencing any type of obstetric complication. However, it was responsible for 18.2% (140) of maternal near miss and 10% (14) of maternal death cases. On multivariate analysis, maternal age and previous cesarean section were shown to be independently associated with an increased risk of severe maternal outcome (near miss or death). Severe maternal outcome due to antepartum and intrapartum hemorrhage was highly prevalent among Brazilian women. Certain risk factors, maternal age and previous cesarean delivery in particular, were associated with the occurrence of bleeding.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Objective To evaluate the occurrence of severe obstetric complications associated with antepartum and intrapartum hemorrhage among women from the Brazilian Network for Surveillance of Severe Maternal Morbidity.Design Multicenter cross-sectional study.Setting Twenty-seven obstetric referral units in Brazil between July 2009 and June 2010.Population A total of 9555 women categorized as having obstetric complications.Methods The occurrence of potentially life-threatening conditions, maternal near miss and maternal deaths associated with antepartum and intrapartum hemorrhage was evaluated. Sociodemographic and obstetric characteristics and the use of criteria for management of severe bleeding were also assessed in these women.Main outcome measures The prevalence ratios with their respective 95% confidence intervals adjusted for the cluster effect of the design, and multiple logistic regression analysis were performed to identify factors independently associated with the occurrence of severe maternal outcome.Results Antepartum and intrapartum hemorrhage occurred in only 8% (767) of women experiencing any type of obstetric complication. However, it was responsible for 18.2% (140) of maternal near miss and 10% (14) of maternal death cases. On multivariate analysis, maternal age and previous cesarean section were shown to be independently associated with an increased risk of severe maternal outcome (near miss or death).Conclusion Severe maternal outcome due to antepartum and intrapartum hemorrhage was highly prevalent among Brazilian women. Certain risk factors, maternal age and previous cesarean delivery in particular, were associated with the occurrence of bleeding.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Frailty is a syndrome that leads to practical harm in the lives of elders, since it is related to increased risk of dependency, falls, hospitalization, institutionalization, and death. The objective of this systematic review was to identify the socio-demographic, psycho-behavioral, health-related, nutritional, and lifestyle factors associated with frailty in the elderly. A total of 4,183 studies published from 2001 to 2013 were detected in the databases, and 182 complete articles were selected. After a comprehensive reading and application of selection criteria, 35 eligible articles remained for analysis. The main factors associated with frailty were: age, female gender, black race/color, schooling, income, cardiovascular diseases, number of comorbidities/diseases, functional incapacity, poor self-rated health, depressive symptoms, cognitive function, body mass index, smoking, and alcohol use. Knowledge of the complexity of determinants of frailty can assist the formulation of measures for prevention and early intervention, thereby contributing to better quality of life for the elderly.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

This study tested whether myocardial extracellular volume (ECV) is increased in patients with hypertension and atrial fibrillation (AF) undergoing pulmonary vein isolation and whether there is an association between ECV and post-procedural recurrence of AF. Hypertension is associated with myocardial fibrosis, an increase in ECV, and AF. Data linking these findings are limited. T1 measurements pre-contrast and post-contrast in a cardiac magnetic resonance (CMR) study provide a method for quantification of ECV. Consecutive patients with hypertension and recurrent AF referred for pulmonary vein isolation underwent a contrast CMR study with measurement of ECV and were followed up prospectively for a median of 18 months. The endpoint of interest was late recurrence of AF. Patients had elevated left ventricular (LV) volumes, LV mass, left atrial volumes, and increased ECV (patients with AF, 0.34 ± 0.03; healthy control patients, 0.29 ± 0.03; p < 0.001). There were positive associations between ECV and left atrial volume (r = 0.46, p < 0.01) and LV mass and a negative association between ECV and diastolic function (early mitral annular relaxation [E'], r = -0.55, p < 0.001). In the best overall multivariable model, ECV was the strongest predictor of the primary outcome of recurrent AF (hazard ratio: 1.29; 95% confidence interval: 1.15 to 1.44; p < 0.0001) and the secondary composite outcome of recurrent AF, heart failure admission, and death (hazard ratio: 1.35; 95% confidence interval: 1.21 to 1.51; p < 0.0001). Each 10% increase in ECV was associated with a 29% increased risk of recurrent AF. In patients with AF and hypertension, expansion of ECV is associated with diastolic function and left atrial remodeling and is a strong independent predictor of recurrent AF post-pulmonary vein isolation.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Oropouche virus (OROV) is a member of the Orthobunyavirus genus in the Bunyaviridae family and a prominent cause of insect-transmitted viral disease in Central and South America. Despite its clinical relevance, little is known about OROV pathogenesis. To define the host defense pathways that control OROV infection and disease, we evaluated OROV pathogenesis and immune responses in primary cells and mice that were deficient in the RIG-I-like receptor signaling pathway (MDA5, RIG-I, or MAVS), downstream regulatory transcription factors (IRF-3 or IRF-7), IFN-β, or the receptor for type I IFN signaling (IFNAR). OROV replicated to higher levels in primary fibroblasts and dendritic cells lacking MAVS signaling, the transcription factors IRF-3 and IRF-7, or IFNAR. In mice, deletion of IFNAR, MAVS, or IRF-3 and IRF-7 resulted in uncontrolled OROV replication, hypercytokinemia, extensive liver damage, and death whereas wild-type (WT) congenic animals failed to develop disease. Unexpectedly, mice with a selective deletion of IFNAR on myeloid cells (CD11c Cre(+) Ifnar(f/f) or LysM Cre(+) Ifnar(f/f)) did not sustain enhanced disease with OROV or La Crosse virus, a closely related encephalitic orthobunyavirus. In bone marrow chimera studies, recipient irradiated Ifnar(-/-) mice reconstituted with WT hematopoietic cells sustained high levels of OROV replication and liver damage, whereas WT mice reconstituted with Ifnar(-/-) bone marrow were resistant to disease. Collectively, these results establish a dominant protective role for MAVS, IRF-3 and IRF-7, and IFNAR in restricting OROV virus infection and tissue injury, and suggest that IFN signaling in non-myeloid cells contributes to the host defense against orthobunyaviruses. Oropouche virus (OROV) is an emerging arthropod-transmitted orthobunyavirus that causes episodic outbreaks of a debilitating febrile illness in humans in countries of South and Central America. The continued expansion of the range and number of its arthropod vectors increases the likelihood that OROV will spread into new regions. At present, the pathogenesis of OROV in humans or other vertebrate animals remains poorly understood. To define cellular mechanisms of control of OROV infection, we performed infection studies in a series of primary cells and mice that were deficient in key innate immune genes involved in pathogen recognition and control. Our results establish that a MAVS-dependent type I IFN signaling pathway has a dominant role in restricting OROV infection and pathogenesis in vivo.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

To analyze the effects of treatment approach on the outcomes of newborns (birth weight [BW] < 1,000 g) with patent ductus arteriosus (PDA), from the Brazilian Neonatal Research Network (BNRN) on: death, bronchopulmonary dysplasia (BPD), severe intraventricular hemorrhage (IVH III/IV), retinopathy of prematurity requiring surgical (ROPsur), necrotizing enterocolitis requiring surgery (NECsur), and death/BPD. This was a multicentric, cohort study, retrospective data collection, including newborns (BW < 1000 g) with gestational age (GA) < 33 weeks and echocardiographic diagnosis of PDA, from 16 neonatal units of the BNRN from January 1, 2010 to Dec 31, 2011. Newborns who died or were transferred until the third day of life, and those with presence of congenital malformation or infection were excluded. Groups: G1 - conservative approach (without treatment), G2 - pharmacologic (indomethacin or ibuprofen), G3 - surgical ligation (independent of previous treatment). Factors analyzed: antenatal corticosteroid, cesarean section, BW, GA, 5 min. Apgar score < 4, male gender, Score for Neonatal Acute Physiology Perinatal Extension (SNAPPE II), respiratory distress syndrome (RDS), late sepsis (LS), mechanical ventilation (MV), surfactant (< 2 h of life), and time of MV. death, O2 dependence at 36 weeks (BPD36wks), IVH III/IV, ROPsur, NECsur, and death/BPD36wks. Student's t-test, chi-squared test, or Fisher's exact test; Odds ratio (95% CI); logistic binary regression and backward stepwise multiple regression. Software: MedCalc (Medical Calculator) software, version 12.1.4.0. p-values < 0.05 were considered statistically significant. 1,097 newborns were selected and 494 newborns were included: G1 - 187 (37.8%), G2 - 205 (41.5%), and G3 - 102 (20.6%). The highest mortality was observed in G1 (51.3%) and the lowest in G3 (14.7%). The highest frequencies of BPD36wks (70.6%) and ROPsur were observed in G3 (23.5%). The lowest occurrence of death/BPD36wks occurred in G2 (58.0%). Pharmacological (OR 0.29; 95% CI: 0.14-0.62) and conservative (OR 0.34; 95% CI: 0.14-0.79) treatments were protective for the outcome death/BPD36wks. The conservative approach of PDA was associated to high mortality, the surgical approach to the occurrence of BPD36wks and ROPsur, and the pharmacological treatment was protective for the outcome death/BPD36wks.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Bartonella species are blood-borne, re-emerging organisms, capable of causing prolonged infection with diverse disease manifestations, from asymptomatic bacteremia to chronic debilitating disease and death. This pathogen can survive for over a month in stored blood. However, its prevalence among blood donors is unknown, and screening of blood supplies for this pathogen is not routinely performed. We investigated Bartonella spp. prevalence in 500 blood donors from Campinas, Brazil, based on a cross-sectional design. Blood samples were inoculated into an enrichment liquid growth medium and sub-inoculated onto blood agar. Liquid culture samples and Gram-negative isolates were tested using a genus specific ITS PCR with amplicons sequenced for species identification. Bartonella henselae and Bartonella quintana antibodies were assayed by indirect immunofluorescence. B. henselae was isolated from six donors (1.2%). Sixteen donors (3.2%) were Bartonella-PCR positive after culture in liquid or on solid media, with 15 donors infected with B. henselae and one donor infected with Bartonella clarridgeiae. Antibodies against B. henselae or B. quintana were found in 16% and 32% of 500 blood donors, respectively. Serology was not associated with infection, with only three of 16 Bartonella-infected subjects seropositive for B. henselae or B. quintana. Bartonella DNA was present in the bloodstream of approximately one out of 30 donors from a major blood bank in South America. Negative serology does not rule out Bartonella spp. infection in healthy subjects. Using a combination of liquid and solid cultures, PCR, and DNA sequencing, this study documents for the first time that Bartonella spp. bacteremia occurs in asymptomatic blood donors. Our findings support further evaluation of Bartonella spp. transmission which can occur through blood transfusions.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física