Epilepsies Associated With Hippocampal Sclerosis.

Hippocampal sclerosis (HS) is considered the most frequent neuropathological finding in patients with mesial temporal lobe epilepsy (MTLE). Hippocampal specimens of pharmacoresistant MTLE patients that underwent epilepsy surgery for seizure control reveal the characteristic pattern of segmental neuronal cell loss and concomitant astrogliosis. However, classification issues of hippocampal lesion patterns have been a matter of intense debate. International consensus classification has only recently provided significant progress for comparisons of neurosurgical and clinic-pathological series between different centers. The respective four-tiered classification system of the International League Against Epilepsy subdivides HS into three types and includes a term of gliosis only, no-HS. Future studies will be necessary to investigate whether each of these subtypes of HS may be related to different etiological factors or with postoperative memory and seizure outcome. Molecular studies have provided potential deeper insights into the pathogenesis of HS and MTLE on the basis of epilepsy-surgical hippocampal specimens and corresponding animal models. These include channelopathies, activation of NMDA receptors, and other conditions related to Ca(2+) influx into neurons, the imbalance of Ca(2+)-binding proteins, acquired channelopathies that increase neuronal excitability, paraneoplastic and non-paraneoplastic inflammatory events, and epigenetic regulation promoting or facilitating hippocampal epileptogenesis. Genetic predisposition for HS is clearly suggested by the high incidence of family history in patients with HS, and by familial MTLE with HS. So far, it is clear that HS is multifactorial and there is no individual pathogenic factor either necessary or sufficient to generate this intriguing histopathological condition. The obvious variety of pathogenetic combinations underlying HS may explain the multitude of clinical presentations, different responses to clinical and surgical treatment. We believe that the stratification of neuropathological patterns can help to characterize specific clinic-pathological entities and predict the postsurgical seizure control in an improved fashion.

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

The Geometric Curvature Of The Spine Of Runners During Maximal Incremental Effort Test.

This study sought to analyse the behaviour of the average spinal posture using a novel investigative procedure in a maximal incremental effort test performed on a treadmill. Spine motion was collected via stereo-photogrammetric analysis in thirteen amateur athletes. At each time percentage of the gait cycle, the reconstructed spine points were projected onto the sagittal and frontal planes of the trunk. On each plane, a polynomial was fitted to the data, and the two-dimensional geometric curvature along the longitudinal axis of the trunk was calculated to quantify the geometric shape of the spine. The average posture presented at the gait cycle defined the spine Neutral Curve. This method enabled the lateral deviations, lordosis, and kyphosis of the spine to be quantified noninvasively and in detail. The similarity between each two volunteers was a maximum of 19% on the sagittal plane and 13% on the frontal (p<0.01). The data collected in this study can be considered preliminary evidence that there are subject-specific characteristics in spinal curvatures during running. Changes induced by increases in speed were not sufficient for the Neutral Curve to lose its individual characteristics, instead behaving like a postural signature. The data showed the descriptive capability of a new method to analyse spinal postures during locomotion; however, additional studies, and with larger sample sizes, are necessary for extracting more general information from this novel methodology.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Adaptação do handebol para a prática em cadeira de rodas

Universidade Estadual de Campinas . Faculdade de Educação Física

Auto-eficácia docente e motivação para a realização do(a) professor(a) de Educação Física Adaptada

Universidade Estadual de Campinas . Faculdade de Educação Física

O jogo de futebol : investigação de sua estrutura, de seus modelos e da inteligencia de jogo, do ponto de vista da complexidade

Universidade Estadual de Campinas . Faculdade de Educação Física

Qualidade de vida e ginastica geral : possiveis aproximações

Universidade Estadual de Campinas . Faculdade de Educação Física

Paramentros fisiologicos, motores e morfologicos de bailarinas classicas

Universidade Estadual de Campinas . Faculdade de Educação Física

Tua imensa torcida e bem feliz... da relação torcedor com o clube

Universidade Estadual de Campinas . Faculdade de Educação Física

Creatina quinase e dor muscular tardia na musculação : estudo experimental em adultos e jovens com o "circuit weight training" e o "multiple set system"

Universidade Estadual de Campinas . Faculdade de Educação Física

Da natureza do espaço ao espaço da natureza : reflexões sobre a relação corpo-natureza em parque publicos urbanos

Universidade Estadual de Campinas. Faculdade de Educação Física

Corpo-sujeito Kadiweu : jogo e esporte

Universidade Estadual de Campinas . Faculdade de Educação Física