In Vitro Effects Of Hydrogen Peroxide Combined With Different Activators For The In-office Bleaching Technique On Enamel.

Abstract Objective. The aim of this study was to evaluate the alteration of human enamel bleached with high concentrations of hydrogen peroxide associated with different activators. Materials and methods. Fifty enamel/dentin blocks (4 × 4 mm) were obtained from human third molars and randomized divided according to the bleaching procedure (n = 10): G1 = 35% hydrogen peroxide (HP - Whiteness HP Maxx); G2 = HP + Halogen lamp (HL); G3 = HP + 7% sodium bicarbonate (SB); G4 = HP + 20% sodium hydroxide (SH); and G5 = 38% hydrogen peroxide (OXB - Opalescence Xtra Boost). The bleaching treatments were performed in three sessions with a 7-day interval between them. The enamel content, before (baseline) and after bleaching, was determined using an FT-Raman spectrometer and was based on the concentration of phosphate, carbonate, and organic matrix. Statistical analysis was performed using two-way ANOVA for repeated measures and Tukey's test. Results. The results showed no significant differences between time of analysis (p = 0.5175) for most treatments and peak areas analyzed; and among bleaching treatments (p = 0.4184). The comparisons during and after bleaching revealed a significant difference in the HP group for the peak areas of carbonate and organic matrix, and for the organic matrix in OXB and HP+SH groups. Tukey's analysis determined that the difference, peak areas, and the interaction among treatment, time and peak was statistically significant (p < 0.05). Conclusion. The association of activators with hydrogen peroxide was effective in the alteration of enamel, mainly with regards to the organic matrix.

Preservation Of The External Jugular Vein In Bilateral Radical Neck Dissections: Technique In Two Cases And Review Of The Literature.

Context. The possibility of cephalic venous hypertension with the resultant facial edema and elevated cerebrospinal fluid pressure continues to challenge head and neck surgeons who perform bilateral radical neck dissections during simultaneous or staged procedures. Case Report. The staged procedure in patients who require bilateral neck dissections allows collateral venous drainage to develop, mainly through the internal and external vertebral plexuses, thereby minimizing the risks of deleterious consequences. Nevertheless, this procedure has disadvantages, such as a delay in definitive therapy, the need for a second hospitalization and anesthesia, and the risk of cutting lymphatic vessels and spreading viable cancer cells. In this paper, we discuss the rationale and feasibility of preserving the external jugular vein. Considering the limited number of similar reports in the literature, two cases in which this procedure was accomplished are described. The relevant anatomy and technique are reviewed and the patients' outcomes are discussed. Conclusion. Preservation of the EJV during bilateral neck dissections is technically feasible, fast, and safe, with clinically and radiologically demonstrated patency.

High Prevalence Of Insulin Resistance Assessed By The Glucose Clamp Technique In Hormonal And Non-hormonal Contraceptive Users.

Objective To assess the prevalence of insulin resistance (IR) and associated factors in contraceptive users. Methods A total of 47 women 18 to 40 years of age with a body mass index (kg/m(2)) < 30, fasting glucose levels < 100 mg/dl and 2-hour glucose level < 140 mg/dl after a 75-g oral glucose load were submitted to a hyperinsulinemic-euglycemic clamp. The women were distributed in tertiles regarding M-values. The analysed variables were use of combined hormonal/non-hormonal contraception, duration of use, body composition, lipid profile, glucose levels and blood pressure. Results IR was detected in 19% of the participants. The women with low M-values presented significantly higher body fat mass, waist-to-hip ratio, fasting insulin, HOMA-IR and were nulligravida, showed > 1 year of contraceptive use and higher triglyceride levels. IR was more frequent among combined oral contraceptive users, however no association was observed after regression analysis. Conclusions The prevalence of IR was high among healthy women attending a family planning clinic independent of the contraceptive method used with possible long-term negative consequences regarding their metabolic and cardiovascular health. Although an association between hormonal contraception and IR could not be found this needs further research. Family planning professionals should be proactive counselling healthy women about the importance of healthy habits.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

The use of fluorescence in situ hybridization in the diagnosis of hidden mosaicism: apropos of three cases of sex chromosome anomalies

FISH has been used as a complement to classical cytogenetics in the detection of mosaicism in sex chromosome anomalies. The aim of this study is to describe three cases in which the final diagnosis could only be achieved by FISH. Case 1 was an 8-year-old 46,XY girl with normal female genitalia referred to our service because of short stature. FISH analysis of lymphocytes with probes for the X and Y centromeres identified a 45,X/46,X,idic(Y) constitution, and established the diagnosis of Turner syndrome. Case 2 was a 21-month-old 46,XY boy with genital ambiguity (penile hypospadias, right testis, and left streak gonad). FISH analysis of lymphocytes and buccal smear identified a 45,X/46,XY karyotype, leading to diagnosis of mixed gonadal dysgenesis. Case 3 was a 47,XYY 19-year-old boy with delayed neuromotor development, learning disabilities, psychological problems, tall stature, small testes, elevated gonadotropins, and azoospermia. FISH analysis of lymphocytes and buccal smear identified a 47,XYY/48,XXYY constitution. Cases 1 and 2 illustrate the phenotypic variability of the 45,X/46,XY mosaicism, and the importance of detection of the 45,X cell line for proper management and follow-up. In case 3, abnormal gonadal function could be explained by the 48,XXYY cell line. The use of FISH in clinical practice is particularly relevant when classical cytogenetic analysis yields normal or uncertain results in patients with features of sex chromosome aneuploidy. Arq Bras Endocrinol Metab. 2012;56(8):545-51