4 resultados para immature stage

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Assessment of central blood pressure (BP) has grown substantially over recent years because evidence has shown that central BP is more relevant to cardiovascular outcomes than peripheral BP. Thus, different classes of antihypertensive drugs have different effects on central BP despite similar reductions in brachial BP. The aim of this study was to investigate the effect of nebivolol, a β-blocker with vasodilator properties, on the biochemical and hemodynamic parameters of hypertensive patients. Experimental single cohort study conducted in the outpatient clinic of a university hospital. Twenty-six patients were recruited. All of them underwent biochemical and hemodynamic evaluation (BP, heart rate (HR), central BP and augmentation index) before and after 3 months of using nebivolol. 88.5% of the patients were male; their mean age was 49.7 ± 9.3 years and most of them were overweight (29.6 ± 3.1 kg/m2) with large abdominal waist (102.1 ± 7.2 cm). There were significant decreases in peripheral systolic BP (P = 0.0020), diastolic BP (P = 0.0049), HR (P < 0.0001) and central BP (129.9 ± 12.3 versus 122.3 ± 10.3 mmHg; P = 0.0083) after treatment, in comparison with the baseline values. There was no statistical difference in the augmentation index or in the biochemical parameters, from before to after the treatment. Nebivolol use seems to be associated with significant reduction of central BP in stage I hypertensive patients, in addition to reductions in brachial systolic and diastolic BP.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Genipap fruits, native to the Amazon region, were classified in relation to their stage of ripeness according to firmness and peel color. The influence of the part of the genipap fruit and ripeness stage on the iridoid and phenolic compound profiles was evaluated by HPLC-DAD-MS(n), and a total of 17 compounds were identified. Geniposide was the major compound in both parts of the unripe genipap fruits, representing >70% of the total iridoids, whereas 5-caffeoylquinic acid was the major phenolic compound. In ripe fruits, genipin gentiobioside was the major compound in the endocarp (38%) and no phenolic compounds were detected. During ripening, the total iridoid content decreased by >90%, which could explain the absence of blue pigment formation in the ripe fruits after their injury. This is the first time that the phenolic compound composition and iridoid contents of genipap fruits have been reported in the literature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Perineural invasion (PNI) and lymphovascular invasion (LVI) have been associated with the risk of local recurrences and lymph node metastasis. The aim of this study was to evaluate the prognostic impact of PNI and LVI in patients with advanced stage squamous cell carcinoma of the tongue and floor of the mouth. One hundred and forty-two patients without previous treatment were selected. These patients underwent radical surgery with neck dissection and adjuvant treatment. Clinicopathological data were retrieved from the medical charts, including histopathology and surgery reports. Univariate analysis was performed to assess the impact of studied variables on survival. Overall survival was negatively influenced by six tumour-related factors: increasing T stage (P = 0.003), more than two clinically positive nodes (P = 0.002), extracapsular spread of lymph node metastasis (P < 0.001), tumour thickness (P = 0.04), PNI (P < 0.001), and LVI (P = 0.012). Disease-free survival was influenced by PNI (P = 0.04), extracapsular spread of lymph node metastasis (P = 0.008), and N stage (P = 0.006). Multivariate analysis showed PNI to be an independent predictor for overall survival (P = 0.01) and disease-free survival (P = 0.03). Thus the presence of PNI in oral carcinoma surgical specimens has a significant impact on survival outcomes in patients with advanced stage tumours submitted to radical surgery and adjuvant radiotherapy/radiochemotherapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.