Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Microbial Evaluation Of Traumatized Teeth Treated With Triple Antibiotic Paste Or Calcium Hydroxide With 2% Chlorhexidine Gel In Pulp Revascularization.

Revascularization outcome depends on microbial elimination because apical repair will not happen in the presence of infected tissues. This study evaluated the microbial composition of traumatized immature teeth and assessed their reduction during different stages of the revascularization procedures performed with 2 intracanal medicaments. Fifteen patients (7-17 years old) with immature teeth were submitted to the revascularization procedures; they were divided into 2 groups according to the intracanal medicament used: TAP group (n = 7), medicated with a triple antibiotic paste, and CHP group (n = 8), dressed with calcium hydroxide + 2% chlorhexidine gel. Samples were taken before any treatment (S1), after irrigation with 6% NaOCl (S2), after irrigation with 2% chlorhexidine (S3), after intracanal dressing (S4), and after 17% EDTA irrigation (S5). Cultivable bacteria recovered from the 5 stages were counted and identified by means of polymerase chain reaction assay (16S rRNA). Both groups had colony-forming unit counts significantly reduced after S2 (P < .05); however, no significant difference was found between the irrigants (S2 and S3, P = .99). No difference in bacteria counts was found between the intracanal medicaments used (P = .95). The most prevalent bacteria detected were Actinomyces naeslundii (66.67%), followed by Porphyromonas endodontalis, Parvimonas micra, and Fusobacterium nucleatum, which were detected in 33.34% of the root canals. An average of 2.13 species per canal was found, and no statistical correlation was observed between bacterial species and clinical/radiographic features. The microbial profile of infected immature teeth is similar to that of primarily infected permanent teeth. The greatest bacterial reduction was promoted by the irrigation solutions. The revascularization protocols that used the tested intracanal medicaments were efficient in reducing viable bacteria in necrotic immature teeth.

Last Instar Larvae And Pupae Of Ourocnemis Archytas And Anteros Formosus (lepidoptera: Riodinidae), With A Summary Of Known Host Plants For The Tribe Helicopini.

Last instar larvae and pupae of Ourocnemis archytas (Lepidoptera: Riodinidae) are described for the first time and compared with those of Anteros formosus, which are also described in detail. Last instars of both species present body covered with long white plumose setae, a row of orange balloon setae on the prothoracic shield, and clusters of perforated cupola organs (PCOs) near the spiracles; differences are the black cephalic capsule, the placement and format of balloon setae cluster, and the presence of enlarged black tips on some plumose setae. Pupae of O. archytas resemble that of Anteros, covered with the last instar setae and with no balloon setae. Characteristics of the immature stages of these two genera could be useful to establish the still unresolved relationship between them. A summary of the host plants of Helicopini is presented, showing a polyphagous pattern for Anteros, recorded in 21 host plant families, which contrasts with the specialized diet observed in Helicopis and Sarota. 

Membrane Lipid Profile Monitored By Mass Spectrometry Detected Differences Between Fresh And Vitrified In Vitro-produced Bovine Embryos.

Summary This study aimed to evaluate the impact of vitrification on membrane lipid profile obtained by mass spectrometry (MS) of in vitro-produced bovine embryos. Matrix-assisted laser desorption ionization-mass spectrometry (MALDI-MS) has been used to obtain individual embryo membrane lipid profiles. Due to conditions of analysis, mainly membrane lipids, most favorably phosphatidylcholines (PCs) and sphingomyelins (SMs) have been detected. The following ions described by their mass-to-charge ratio (m/z) and respective attribution presented increased relative abundance (1.2-20×) in the vitrified group: 703.5 [SM (16:0) + H]+; 722.5 [PC (40:3) + Na]+; 758.5 [PC (34:2) + H]+; 762.5 [PC (34:0) + H]+; 790.5 [PC (36:0) + H]+ and 810.5 [PC (38:4) + H]+ and/or [PC (36:1) + Na]+. The ion with a m/z 744.5 [PCp (34:1) and/or PCe (34:2)] was 3.4-fold more abundant in the fresh group. Interestingly, ions with m/z 722.5 or 744.5 indicate the presence of lipid species, which are more resistant to enzymatic degradation as they contain fatty acyl residues linked through ether type bonds (alkyl ether or plasmalogens, indicated by the lowercase 'e' and 'p', respectively) to the glycerol structure. The results indicate that cryopreservation impacts the membrane lipid profile, and that these alterations can be properly monitored by MALDI-MS. Membrane lipids can therefore be evaluated by MALDI-MS to monitor the effect of cryopreservation on membrane lipids, and to investigate changes in lipid profile that may reflect the metabolic response to the cryopreservation stress or changes in the environmental conditions.

Caracterização morfológica das sementes e plântulas de seis espécies invasoras do gênero Solanum L

Morphological caracterization of the seeds and seedlings of six weed especies of the genus Solanum L. The seeds of the genus Solanum are very similar, however, the association of their external characteristics with the anatomical features, such as hilum shape, the texture and the type of the seed coat sculptures, as well as the curved (circulated or coiled) shape of the embryo, are parameters of great importance in the taxonomical identification at the species level. It is are presented the morphological descriptions of the genus Solanum and a more detailed description of each studied species in terms of seed and seedling structures, including illustrations and taxonomical keys for the identification of Solanum aculeatissimum Jacq., S. americanum Mill., S. ciliatum Lam., S. sisymbriifolium Lam., S. sordidum Sendt. e S. viarum Dunal. There are also indications of the common names, the type of reproduction and dispersion, the crops in which the species is considered as a weed and the agricultural seeds in which it is found as a weed seed.