15 resultados para host-parasitic relationship

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

80.00% 80.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Mistletoe can have a major impact on the fitness of the host plant. If there is more than one species of mistletoe on the same host tree, the overall impact might be amplified. We report the occurrence of more than one species of mistletoe on the same host tree. Although it is not a rule in the field, to our knowledge, there have been no studies of this topic. In most cases, two species of mistletoe were recorded on the same host tree, although we recorded three species of mistletoe on one occasion. This demonstrates that different species of mistletoe can be compatible with the same host species. Therefore, compatibility (structural and physiological) might be an important factor for the occurrence of mistletoe. Recent studies have shown that if the mistletoe does not recognize the host species, the deposited seeds will germinate but the haustorium will not penetrate the host branch. This is probably the primary mechanism in the establishment of more than one species of mistletoe on the same host, which can trigger a cascade of harmful effects for the host species.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Last instar larvae and pupae of Ourocnemis archytas (Lepidoptera: Riodinidae) are described for the first time and compared with those of Anteros formosus, which are also described in detail. Last instars of both species present body covered with long white plumose setae, a row of orange balloon setae on the prothoracic shield, and clusters of perforated cupola organs (PCOs) near the spiracles; differences are the black cephalic capsule, the placement and format of balloon setae cluster, and the presence of enlarged black tips on some plumose setae. Pupae of O. archytas resemble that of Anteros, covered with the last instar setae and with no balloon setae. Characteristics of the immature stages of these two genera could be useful to establish the still unresolved relationship between them. A summary of the host plants of Helicopini is presented, showing a polyphagous pattern for Anteros, recorded in 21 host plant families, which contrasts with the specialized diet observed in Helicopis and Sarota. 

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The 'dilution effect' (DE) hypothesis predicts that diverse host communities will show reduced disease. The underlying causes of pathogen dilution are complex, because they involve non-additive (driven by host interactions and differential habitat use) and additive (controlled by host species composition) mechanisms. Here, we used measures of complementarity and selection traditionally employed in the field of biodiversity-ecosystem function (BEF) to quantify the net effect of host diversity on disease dynamics of the amphibian-killing fungus Batrachochytrium dendrobatidis (Bd). Complementarity occurs when average infection load in diverse host assemblages departs from that of each component species in uniform populations. Selection measures the disproportionate impact of a particular species in diverse assemblages compared with its performance in uniform populations, and therefore has strong additive and non-additive properties. We experimentally infected tropical amphibian species of varying life histories, in single- and multi-host treatments, and measured individual Bd infection loads. Host diversity reduced Bd infection in amphibians through a mechanism analogous to complementarity (sensu BEF), potentially by reducing shared habitat use and transmission among hosts. Additionally, the selection component indicated that one particular terrestrial species showed reduced infection loads in diverse assemblages at the expense of neighbouring aquatic hosts becoming heavily infected. By partitioning components of diversity, our findings underscore the importance of additive and non-additive mechanisms underlying the DE.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim was to evaluate the relationship between orofacial function, dentofacial morphology, and bite force in young subjects. Three hundred and sixteen subjects were divided according to dentition stage (early, intermediate, and late mixed and permanent dentition). Orofacial function was screened using the Nordic Orofacial Test-Screening (NOT-S). Orthodontic treatment need, bite force, lateral and frontal craniofacial dimensions and presence of sleep bruxism were also assessed. The results were submitted to descriptive statistics, normality and correlation tests, analysis of variance, and multiple linear regression to test the relationship between NOT-S scores and the studied independent variables. The variance of NOT-S scores between groups was not significant. The evaluation of the variables that significantly contributed to NOT-S scores variation showed that age and presence of bruxism related to higher NOT-S total scores, while the increase in overbite measurement and presence of closed lip posture related to lower scores. Bite force did not show a significant relationship with scores of orofacial dysfunction. No significant correlations between craniofacial dimensions and NOT-S scores were observed. Age and sleep bruxism were related to higher NOT-S scores, while the increase in overbite measurement and closed lip posture contributed to lower scores of orofacial dysfunction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Collection of triatomines in domestic, peridomestic and sylvatic environments in states of Bahia and Rio Grande do Sul, Northeastern and Southern Brazil respectively, and isolation of Trypanosoma cruzi strains. First, the captured triatomines were identified using insect identification keys, then their intestinal content was examined by abdominal compression, and the samples containing trypanosomatid forms were inoculated in LIT medium and Swiss mice. Six triatomine species were collected in cities in Bahia, namely Panstrongylus geniculatus (01), Triatoma melanocephala (11), T. lenti (94), T. pseudomaculata (02), T. sherlocki (26) and T. sordida (460), and two in cities in Rio Grande do Sul, namely T. circummaculata (11) and T. rubrovaria (115). Out of the specimens examined, T. cruzi was isolated from 28 triatomine divided into four different species: T. melanocephala (one), T. lenti (one), T. rubrovaria (16) and T. sordida (10). Their index of natural infection by T. cruzi was 6.4%. The isolation of T. cruzi strains from triatomines found in domestic and peridomestic areas shows the potential risk of transmission of Chagas disease in the studied cities. The maintenance of those T. cruzi strains in laboratory is intended to promote studies that facilitate the understanding of the parasite-vector-host relationship.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Muscle strength and functional independence are considered to be determinants of frailty levels among elderly people. The aim here was to compare lower-limb muscle strength (LLMS) with functional independence in relation to sex, age and number of frailty criteria, and to ascertain the influence of these variables on elderly outpatients' independence. Quantitative cross-sectional study, in a tertiary hospital. The study was conducted on 150 elderly outpatients of both sexes who were in a cognitive condition allowing oral communication, between October 2005 and October 2007. The following instruments were used: five-times sit-to-stand test (FTSST), Functional Independence Measurement (FIM) and Lawton's Instrumental Activities of Daily Living Scale (IADL). Descriptive, comparative, multivariate, univariate and Cronbach alpha analyses were performed. The mean time taken in the FTSST was 21.7 seconds; the mean score for FIM was 82.2 and for IADL was 21.2; 44.7% of the subjects presented 1-2 frailty criteria and 55.3% > 3 criteria. There was a significant association between LLMS and functional independence in relation to the number of frailty criteria, without homogeneity regarding sex and age. Functional independence showed significant influence from sex and LLMS. Elderly individuals with 1 or 2 frailty criteria presented greater independence in all FTSST scores. The subjects with higher LLMS presented better functional independence.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Traira (Hoplias malabaricus) is a neotropical fish that is widely distributed in freshwater environments in South America. In the present study, we documented the occurrence of metacercariae of Austrodiplostomum spp. (Diplostomidae) in the eyes and cranial cavity of H. malabaricus and described parasite-induced behavioral changes in the host. The fish were collected from the upper São Francisco River, in the Serra da Canastra mountain range, Minas Gerais, transported alive to the laboratory, observed for 2 weeks, and subsequently examined for parasites. Of the 35 fish examined, 28 (80 %) had free metacercariae in the vitreous humor (mean intensity=95.4; mean abundance=76.3), and 24 (68.57 %) had free metacercariae in the cranial cavity, mainly concentrated below the floor of the brain, at the height of the ophthalmic lobe (mean intensity=12.91; mean abundance=8.85). Specimens of H. malabaricus with a high intensity of infection in the brain displayed changes in swimming behavior.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ant foraging on foliage can substantially affect how phytophagous insects use host plants and represents a high predation risk for caterpillars, which are important folivores. Ant-plant-herbivore interactions are especially pervasive in cerrado savanna due to continuous ant visitation to liquid food sources on foliage (extrafloral nectaries, insect honeydew). While searching for liquid rewards on plants, aggressive ants frequently attack or kill insect herbivores, decreasing their numbers. Because ants vary in diet and aggressiveness, their effect on herbivores also varies. Additionally, the differential occurrence of ant attractants (plant and insect exudates) on foliage produces variable levels of ant foraging within local floras and among localities. Here, we investigate how variation of ant communities and of traits among host plant species (presence or absence of ant attractants) can change the effect of carnivores (predatory ants) on herbivore communities (caterpillars) in a cerrado savanna landscape. We sampled caterpillars and foliage-foraging ants in four cerrado localities (70-460 km apart). We found that: (i) caterpillar infestation was negatively related with ant visitation to plants; (ii) this relationship depended on local ant abundance and species composition, and on local preference by ants for plants with liquid attractants; (iii) this was not related to local plant richness or plant size; (iv) the relationship between the presence of ant attractants and caterpillar abundance varied among sites from negative to neutral; and (v) caterpillars feeding on plants with ant attractants are more resistant to ant predation than those feeding on plants lacking attractants. Liquid food on foliage mediates host plant quality for lepidopterans by promoting generalized ant-caterpillar antagonism. Our study in cerrado shows that the negative effects of generalist predatory ants on herbivores are detectable at a community level, affecting patterns of abundance and host plant use by lepidopterans. The magnitude of ant-induced effects on caterpillar occurrence across the cerrado landscape may depend on how ants use plants locally and how they respond to liquid food on plants at different habitats. This study enhances the relevance of plant-ant and ant-herbivore interactions in cerrado and highlights the importance of a tritrophic perspective in this ant-rich environment.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The 2005 National Institutes of Health (NIH) Consensus Conference proposed new criteria for diagnosing and scoring the severity of chronic graft-versus-host disease (GVHD). The 2014 NIH consensus maintains the framework of the prior consensus with further refinement based on new evidence. Revisions have been made to address areas of controversy or confusion, such as the overlap chronic GVHD subcategory and the distinction between active disease and past tissue damage. Diagnostic criteria for involvement of mouth, eyes, genitalia, and lungs have been revised. Categories of chronic GVHD should be defined in ways that indicate prognosis, guide treatment, and define eligibility for clinical trials. Revisions have been made to focus attention on the causes of organ-specific abnormalities. Attribution of organ-specific abnormalities to chronic GVHD has been addressed. This paradigm shift provides greater specificity and more accurately measures the global burden of disease attributed to GVHD, and it will facilitate biomarker association studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Human land use tends to decrease the diversity of native plant species and facilitate the invasion and establishment of exotic ones. Such changes in land use and plant community composition usually have negative impacts on the assemblages of native herbivorous insects. Highly specialized herbivores are expected to be especially sensitive to land use intensification and the presence of exotic plant species because they are neither capable of consuming alternative plant species of the native flora nor exotic plant species. Therefore, higher levels of land use intensity might reduce the proportion of highly specialized herbivores, which ultimately would lead to changes in the specialization of interactions in plant-herbivore networks. This study investigates the community-wide effects of land use intensity on the degree of specialization of 72 plant-herbivore networks, including effects mediated by the increase in the proportion of exotic plant species. Contrary to our expectation, the net effect of land use intensity on network specialization was positive. However, this positive effect of land use intensity was partially canceled by an opposite effect of the proportion of exotic plant species on network specialization. When we analyzed networks composed exclusively of endophagous herbivores separately from those composed exclusively of exophagous herbivores, we found that only endophages showed a consistent change in network specialization at higher land use levels. Altogether, these results indicate that land use intensity is an important ecological driver of network specialization, by way of reducing the local host range of herbivore guilds with highly specialized feeding habits. However, because the effect of land use intensity is offset by an opposite effect owing to the proportion of exotic host species, the net effect of land use in a given herbivore assemblage will likely depend on the extent of the replacement of native host species with exotic ones.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The main aim of this investigation was to verify the relationship of the variables measured during a 3-minute all-out test with aerobic (i.e., peak oxygen uptake [(Equation is included in full-text article.)] and intensity corresponding to the lactate minimum [LMI]) and anaerobic parameters (i.e., anaerobic work) measured during a 400-m maximal performance. To measure force continually and to avoid the possible influences caused by turns, the 3-minute all-out effort was performed in tethered swimming. Thirty swimmers performed the following tests: (a) a 3-minute all-out tethered swimming test to determine the final force (equivalent to critical force: CF3-MIN) and the work performed above CF3-MIN (W'3-MIN), (b) a LMI protocol to determine the LMI during front crawl swimming, and (c) a 400-m maximal test to determine the (Equation is included in full-text article.)and total anaerobic contribution (WANA). Correlations between the variables were tested using the Pearson's correlation test (p ≤ 0.05). CF3-MIN (73.9 ± 13.2 N) presented a high correlation with the LMI (1.33 ± 0.08 m·s; p = 0.01) and (Equation is included in full-text article.)(4.5 ± 1.2 L·min; p = 0.01). However, the W'3-MIN (1,943.2 ± 719.2 N·s) was only moderately correlated with LMI (p = 0.02) and (Equation is included in full-text article.)(p = 0.01). In summary, CF3-MIN determined during the 3-minute all-out effort is associated with oxidative metabolism and can be used to estimate the aerobic capacity of swimmers. In contrast, the anaerobic component of this model (W'3-MIN) is not correlated with WANA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In our previous study, we have found that 5-cyclopropyl-2-[1-(2-fluoro-benzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-pyrimidin-4-ylamine (BAY 41-2272), a guanylate cyclase agonist, activates human monocytes and the THP-1 cell line to produce the superoxide anion, increasing in vitro microbicidal activity, suggesting that this drug can be used to modulate immune functioning in primary immunodeficiency patients. In the present work, we investigated the potential of the in vivo administration of BAY 41-2272 for the treatment of Candida albicans and Staphylococcus aureus infections introduced via intraperitoneal and subcutaneous inoculation. We found that intraperitoneal treatment with BAY 41-2272 markedly increased macrophage-dependent cell influx to the peritoneum in addition to macrophage functions, such as spreading, zymosan particle phagocytosis and nitric oxide and phorbol myristate acetate-stimulated hydrogen peroxide production. Treatment with BAY 41-2272 was highly effective in reducing the death rate due to intraperitoneal inoculation of C. albicans, but not S. aureus. However, we found that in vitro stimulation of peritoneal macrophages with BAY 41-2272 markedly increased microbicidal activities against both pathogens. Our results show that the prevention of death by the treatment of C. albicans-infected mice with BAY 41-2272 might occur primarily by the modulation of the host immune response through macrophage activation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to check for any significant differences in perceived quality of life, specifically aspects of a physical nature, among volunteers who are more physically active and those less physically active in a university community. The sample consisted of 1,966 volunteers in a university community in Brazil. To assess physical activity levels, volunteers responded to the International Physical Activity Questionnaire (IPAQ), and to analyse the perception of quality of life they responded to WHOQOL-bref, which is classified into three groups according to level of physical activity, taking into account the metabolic equivalent index (MET) over a full week. For comparison, consideration was given to the first and third tertiles, respectively, namely groups of more and less active students. The results indicated that individuals who engaged in more physical activity had a more positive perception of quality of life compared to those who were less active in physical aspects related to the ability to work, energy for day-to-day activities and locomotion.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A new species of dactylogyrid monogenean, Apedunculata discoidea gen. n., sp. n. is described and illustrated from the gills of the freshwater fish Prochilodus lineatus (Valenciennes, 1837) in pisciculture ponds from Pirassununga, São Paulo, Brazil. Diagnostic characters of the new genus and species are: 1) vagina dextrolateral slightly sclerotised, opening anteriorly at level of copulatory complex; 2) copulatory organ coiled with two counterclockwise rings; 3) Accessory piece distal and not articulated; 4) body disk-shaped, lacking a peduncle.