8 resultados para histopathological alterations
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Both high-fat diet and exposure to endocrine-disrupting chemicals have been implicated in susceptibility to pathological prostate lesions, but the consequences of combining the two have not yet been examined. We evaluated the effects of gestational and postnatal exposure to a high-fat diet (20% fat) and low doses of di-n-butyl phthalate (DBP; 5mg/kg/day), individually or in combination, on the tissue response and incidence of pathological lesions in the ventral prostate of adult gerbils. Continuous intake of a high-fat diet caused dyslipidemia, hypertrophy, and promoted the development of inflammatory, premalignant and malignant prostate lesions, even in the absence of obesity. Life-time DBP exposure was obesogenic and dyslipidemic and increased the incidence of premalignant prostate lesions. Combined exposure to DBP and a high-fat diet also caused prostate hypertrophy, but the effects were less severe than those of individual treatments; combined exposure neither induced an inflammatory response nor altered serum lipid content.
Resumo:
Hypertensive patients exhibit higher cardiovascular risk and reduced lung function compared with the general population. Whether this association stems from the coexistence of two highly prevalent diseases or from direct or indirect links of pathophysiological mechanisms is presently unclear. This study investigated the association between lung function and carotid features in non-smoking hypertensive subjects with supposed normal lung function. Hypertensive patients (n = 67) were cross-sectionally evaluated by clinical, hemodynamic, laboratory, and carotid ultrasound analysis. Forced vital capacity, forced expired volume in 1 second and in 6 seconds, and lung age were estimated by spirometry. Subjects with ventilatory abnormalities according to current guidelines were excluded. Regression analysis adjusted for age and prior smoking history showed that lung age and the percentage of predicted spirometric parameters associated with common carotid intima-media thickness, diameter, and stiffness. Further analyses, adjusted for additional potential confounders, revealed that lung age was the spirometric parameter exhibiting the most significant regression coefficients with carotid features. Conversely, plasma C-reactive protein and matrix-metalloproteinases-2/9 levels did not influence this relationship. The present findings point toward lung age as a potential marker of vascular remodeling and indicate that lung and vascular remodeling might share common pathophysiological mechanisms in hypertensive subjects.
Resumo:
Congenital muscular dystrophy with laminin α2 chain deficiency (MDC1A) is one of the most severe forms of muscular disease and is characterized by severe muscle weakness and delayed motor milestones. The genetic basis of MDC1A is well known, yet the secondary mechanisms ultimately leading to muscle degeneration and subsequent connective tissue infiltration are not fully understood. In order to obtain new insights into the molecular mechanisms underlying MDC1A, we performed a comparative proteomic analysis of affected muscles (diaphragm and gastrocnemius) from laminin α2 chain-deficient dy(3K)/dy(3K) mice, using multidimensional protein identification technology combined with tandem mass tags. Out of the approximately 700 identified proteins, 113 and 101 proteins, respectively, were differentially expressed in the diseased gastrocnemius and diaphragm muscles compared with normal muscles. A large portion of these proteins are involved in different metabolic processes, bind calcium, or are expressed in the extracellular matrix. Our findings suggest that metabolic alterations and calcium dysregulation could be novel mechanisms that underlie MDC1A and might be targets that should be explored for therapy. Also, detailed knowledge of the composition of fibrotic tissue, rich in extracellular matrix proteins, in laminin α2 chain-deficient muscle might help in the design of future anti-fibrotic treatments. All MS data have been deposited in the ProteomeXchange with identifier PXD000978 (http://proteomecentral.proteomexchange.org/dataset/PXD000978).
Resumo:
Minor structural alterations of the vocal fold cover are frequent causes of voice abnormalities. They may be difficult to diagnose, and are expressed in different manners. Cases of intracordal cysts, sulcus vocalis, mucosal bridge, and laryngeal micro-diaphragm form the group of minor structural alterations of the vocal fold cover investigated in the present study. The etiopathogenesis and epidemiology of these alterations are poorly known. To evaluate the existence and anatomical characterization of minor structural alterations in the vocal folds of newborns. 56 larynxes excised from neonates of both genders were studied. They were examined fresh, or defrosted after conservation via freezing, under a microscope at magnifications of 25× and 40×. The vocal folds were inspected and palpated by two examiners, with the aim of finding minor structural alterations similar to those described classically, and other undetermined minor structural alterations. Larynges presenting abnormalities were submitted to histological examination. Six cases of abnormalities were found in different larynges: one (1.79%) compatible with a sulcus vocalis and five (8.93%) compatible with a laryngeal micro-diaphragm. No cases of cysts or mucosal bridges were found. The observed abnormalities had characteristics similar to those described in other age groups. Abnormalities similar to sulcus vocalis or micro-diaphragm may be present at birth.
Resumo:
Mucositis induced by anti-neoplastic drugs is an important, dose-limiting and costly side-effect of cancer therapy. To evaluate the effect of the topical application of S-nitrosoglutathione (GSNO), a nitric oxide donor, on 5-fluorouracil (5-FU)-induced oral mucositis in hamsters. Oral mucositis was induced in male hamsters by two intraperitoneal administrations of 5-FU on the first and second days of the experiment (60 and 40 mg/kg, respectively) followed by mechanical trauma on the fourth day. Animals received saline, HPMC or HPMC/GSNO (0.1, 0.5 or 2.0 mM) 1 h prior to the 5-FU injection and twice a day for 10 or 14 days. Samples of cheek pouches were harvested for: histopathological analysis, TNF-α and IL-1β levels, immunohistochemical staining for iNOS, TNF-α, IL-1β, Ki67 and TGF-β RII and a TUNEL assay. The presence and levels of 39 bacterial taxa were analyzed using the Checkerboard DNA-DNA hybridization method. The profiles of NO released from the HPMC/GSNO formulations were characterized using chemiluminescence. The HPMC/GSNO formulations were found to provide sustained release of NO for more than 4 h at concentration-dependent rates of 14 to 80 nmol/mL/h. Treatment with HPMC/GSNO (0.5 mM) significantly reduced mucosal damage, inflammatory alterations and cell death associated with 5-FU-induced oral mucositis on day 14 but not on day 10. HPMC/GSNO administration also reversed the inhibitory effect of 5-FU on cell proliferation on day 14. In addition, we observed that the chemotherapy significantly increased the levels and/or prevalence of several bacterial species. Topical HPMC/GSNO accelerates mucosal recovery, reduces inflammatory parameters, speeds up re-epithelization and decreases levels of periodontopathic species in mucosal ulcers.
Resumo:
Metastasizing pleomorphic adenoma (MPA) is a rare tumour, and its mechanism of metastasis still is unknown. To date, there has been no study on MPA genomics. We analysed primary and secondary MPAs with array comparative genomic hybridization to identify somatic copy number alterations and affected genes. Tumour DNA samples from primary (parotid salivary gland) and secondary (scalp skin) MPAs were subjected to array comparative genomic hybridization investigation, and the data were analysed with NEXUS COPY NUMBER DISCOVERY. The primary MPA showed copy number losses affecting 3p22.2p14.3 and 19p13.3p123, and a complex pattern of four different deletions at chromosome 6. The 3p deletion encompassed several genes: CTNNB1, SETD2, BAP1, and PBRM1, among others. The secondary MPA showed a genomic profile similar to that of the primary MPA, with acquisition of additional copy number changes affecting 9p24.3p13.1 (loss), 19q11q13.43 (gain), and 22q11.1q13.33 (gain). Our findings indicated a clonal origin of the secondary MPA, as both tumours shared a common profile of genomic copy number alterations. Furthermore, we were able to detect in the primary tumour a specific pattern of copy number alterations that could explain the metastasizing characteristic, whereas the secondary MPA showed a more unbalanced genome.
Resumo:
Dystrophin-deficient muscles have repeated cycles of necrosis and regeneration, being susceptible to injury induced by muscle contractions. Some studies have demonstrated that tendons are also affected in mdx mice, based especially on the changes in biomechanical properties arising from the respective linked muscles. However, most studies have focused only on alterations in the myotendinous junction. Thus, the purpose of this work was to study biochemical and morphological alterations in the Achilles tendons of 60-day-old mdx mice. Hydroxyproline quantification, showed higher collagen concentration in the mdx mice as compared with the control. No difference between the tendons of both groups was found in the noncollagenous proteins dosage, and in the amount of collagen type III detected in the western blotting analysis. The zymography for gelatinases detection showed higher amounts of metaloproteinase-2 (active isoform) and of metalloproteinase-9 (latent isoform) in the mdx mice. Measurements of birefringence, using polarization microscopy, showed higher molecular organization of the collagen fibers in the tendons of mdx mice in comparison to the control group, with presence of larger areas of crimp. Ponceau SS-stained tendon sections showed stronger staining of the extracellular matrix in the mdx groups. Toluidine blue-stained sections showed more intense basophilia in tendons of the control group. In morphometry, a higher number of inflammatory cells was detected in the epitendon of mdx group. In conclusion, the Achilles tendon of 60-day-old mdx mice presents higher collagen concentration and organization of the collagen fibers, enhanced metalloproteinase-2 activity, as well as prominent presence of inflammatory cells and lesser proteoglycans.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.