Sinonasal Disorders In Hematopoietic Stem Cell Transplantation.

hematopoietic stem cell transplantation (HSCT) is associated with more respiratory infections due to immunosuppression. this study aimed to verify the frequency of rhinosinusitis after HSCT, and the association between rhinosinusitis and chronic graft vs. host disease (GVHD) and type of transplantation, clinical treatment, surgical treatment, and survival. this was a retrospective study in a tertiary university hospital. A total of 95 patients with hematological diseases undergoing HSCT between 1996 and 2011 were selected. chronic myeloid leukemia was the most prevalent disease. The type of transplant most often performed was the allogenic type (85.26%). The frequency of rhinosinusitis was 36%, with no difference between the autologous and the allogenic types. Chronic GVHD occurred in 30% of patients. Patients with GVHD had a higher frequency and recurrence of rhinosinusitis, in addition to more frequent need for endoscopic sinusectomy and decreased overall survival. there was a higher frequency of rhinosinusitis in HSCT and GVHD. The type of transplant does not appear to predispose to the occurrence of rhinosinusitis. GVHD seems to be an aggravating factor and requires a more stringent treatment.

The Real-life Experience With Cardiovascular Complications In The First Dose Of Fingolimod For Multiple Sclerosis.

Fingolimod is a new and efficient treatment for multiple sclerosis (MS). The drug administration requires special attention to the first dose, since cardiovascular adverse events can be observed during the initial six hours of fingolimod ingestion. The present study consisted of a review of cardiovascular data on 180 patients with MS receiving the first dose of fingolimod. The rate of bradycardia in these patients was higher than that observed in clinical trials with very strict inclusion criteria for patients. There were less than 10% of cases requiring special attention, but no fatal cases. All but one patient continued the treatment after this initial dose. This is the first report on real-life administration of fingolimod to Brazilian patients with MS, and one of the few studies with these characteristics in the world.

Radiotherapy Does Not Impair Dentin Adhesive Properties In Head And Neck Cancer Patients.

This study evaluated the influence of radiotherapy on the dentin bond strength of teeth extracted from patients who had undergone head and neck radiotherapy. A total of 36 samples were divided into two experimental groups: group I (control group, n = 18) and group II (in vivo irradiated group, n = 18). Groups I and II were further separated into three subgroups (six specimens per subgroup), which were further assigned to the three adhesive system protocols employed: Single Bond 2 (SB) (3M ESPE), Easy Bond (EB) (3M ESPE) and Clearfil SE Bond (CSE) (Kuraray). The adhesive systems were applied to the prepared surface according to the manufacturers' instructions and restored using composite resin (Filtek Supreme, 3M ESPE). After 24 h in deionised water (37(o)C), teeth were horizontally and vertically cut to obtain beam specimens with a cross-section area of 0.8 ± 1.0 mm(2). Specimens were tested in tension using a universal testing machine at a cross-speed of 0.5 mm/min. Fracture patterns were observed under SEM. Data was analysed by two-way analysis of variance (p ≤ 0.05). No statistically significant difference was found between the irradiated (R/SB = 44.66 ± 10.12 MPa; R/EB = 41.48 ± 12.71 MPa; and R/CSE = 46.01 ± 6.98 MPa) and control group (C/SB = 39.12 ± 9.51 MPa; C/EB = 42.40 ± 6.66 MPa; and C/CSE = 36.58 ± 7.06 MPa) for any of the adhesive systems. All groups presented a predominance of mixed fracture modes. Head and neck radiotherapy did not affect dentin bond strength for the adhesive materials tested in this study.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Tua imensa torcida e bem feliz... da relação torcedor com o clube

Universidade Estadual de Campinas . Faculdade de Educação Física

Modelo para análise do ataque no futebol = : A model to analyze soccer offensive phase

Universidade Estadual de Campinas . Faculdade de Educação Física