39 resultados para estruturas de sobrevivência
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Descriptors in multivariate image analysis applied to quantitative structure-activity relationship (MIA-QSAR) are pixels of bidimensional images of chemical structures (drawings), which were used to model the trichomonicidal activities of a series of benzimidazole derivatives. The MIA-QSAR model showed good predictive ability, with r², q² and r val. ext.² of 0.853, 0.519 and 0.778, respectively, which are comparable to the best values obtained by CoMFA e CoMSIA for the same series. A MIA-based analysis was also performed by using images of alphabetic letters with the corresponding numeric ordering as dependent variables, but no correlation was found, supporting that MIA-QSAR is not arbitrary.
Resumo:
This paper investigates the relationship between structural and semantic properties of factive sentences and the pattern of extraction exhibited. It is argued that a classification as weak or strong island is unfeasible for what has been termed Factive Island. The kinds of structures allowed as factive complements are analyzed as well as their corresponding behavior concerning extraction. The common feature these structures show is their presuppositional character, which is derived from a selection requirement. I assume that factive predicates select a [+ specific] complement. The differences showed concerning extraction constitute a spontaneous effect from the structural way each construction may satisfy this requirement.
Resumo:
The objective of this study was to evaluate the horizontal and vertical structures of tree community in regeneration in a fragment of a secondary riparian forest at approximately 30 years of age and to identify the most abundant species in each fragment of the forest to determine the sucessional stage. An area of 800 m² was subdivided into 16 samples of 10 x 5 m and all individuals with DBH ≥ 1 cm were sampled and identified for the following analyzes: horizontal parameters (DR, FR, DoR, IVC and IVI), vertical parameters (PSR and RNR) and mixed parameters, from of value of increased importance index (IVIa). The survey measured 689 individuals, belonging to 38 families, 74 genus and 109 species. The total density was 8,614 individuals/ha. The index of Shannon´s diversity was 3.99 and the index of Pielou´s equability was 0.85. Tibouchina pulchra, Psychotria suterella and Endlicheria paniculata obtained high values of IVIa. Guarea macrophylla, Gomidesia anacardiaefolia, Xylopia langsdorffiana and Endlicheria paniculata achieved high values of RNT, indicating adequate natural regeneration in the plot. The initial secondary and umbrophylous species showed the highest ecological importance in this fragment of the forest, with the highest values of sociologic position and importance index. Furthermore, the presence of late secondary species in all layers suggest that the studied fragment is in intermediate succession degree.
Resumo:
This paper presents the behavior of three bored piles conducted in diabasic soil submitted to uplift forces. The piles were built at the site for Experimental Studies in Soil Mechanics and Foundations of UNICAMP, located in the city of Campinas, Brazil. Field tests have already been conducted at the site (SPT, CPT, DMT and PMT), as well as laboratory tests by using sample soils taken from a well up to 17 m deep. The water table is not checked until a depth of 17 m. In order to check the behavior of the piles when submitted to uplift forces, slow static load tests were carried out as the recommendations of NBR 12131. The carrying capacity of these piles was also provided by means of theoretical methods, appropriate for uplift forces, and through semi-empirical methods appropriate for compression forces, considering only the portion of lateral resistance. The values estimated by using the considered methods were compared to those obtained by means of load tests. One of the tested piles was extracted from the soil to be the subject of a study on its geometry.
Resumo:
We estimate litter production and leaf decomposition rate in a cerradão area, physiognomy little studied and very threatened in São Paulo State. During the period of study, litter production was 5646.9 kg.ha-1.year-1, which the 'leaf' fraction corresponded to 4081.2 kg.ha¹.year¹; the 'branch' fraction, to 1066.1 kg.ha-1.year-1; the 'reproductive structures' fraction, to 434.1 kg.ha-1.year-1; and the 'miscellaneous' fraction to 65.5 kg.ha-1.year-1. Litter production was highly seasonal and negatively correlated with relative humidity and air temperature. Leaf production was negatively correlated with relative humidity, rainfall, and air temperature. There was no significant difference between litter production found in this study and those in two other sites with cerradão and semideciduous forest, but these physiognomies differed significantly from the cerrado sensu stricto. Leaf decomposition rate (K) was 0.56. Half-life of the decomposing material was 1.8 years and turnover time was 2.3 years.
Resumo:
Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.
Resumo:
In this paper I present some evidencie that forces us to conclude that within the Minimalist Program (Chomsky 1993; 1995), Binding Theory (BT) should be computed after LF (Logical Form). I show that derivations leading to structures containing violations of BT-Principles must converge at LF, since less economical alternative derivations respecting those principles are also ungrammatical. Being irrelevant to the notion of convergence, BT must apply after LF. A similar reasoning reveals that the Theta-Criterion should have the status of a bare output condition appling at LF, since less economical derivations are allowed by the computational system to prevent violations of it.
Resumo:
This paper aims to discuss the future -- and the proper survival of Textlinguistics this millenium, and the challenges it has to face in order to contribute to the development of Human Sciences in a new era.
Resumo:
This work aimed at determining the occurrence of heat resistant molds during the aseptic processing of tomato pulp (8° BRIX). During tomato harvest, 9 lots were sampled (3 at the beginning, 3 at the apex and 3 at the end of harvest) and other 5 lots were sampled between harvest. For each lot, the enumeration of heat resistant molds was carried out in samples collected during the aseptic process. The mean count of heat resistant molds was relatively low, ranging from <1 to 8CFU/100mL of sample. The higher counts were observed in the raw material and the pre-wash and transportation water. Fifty strains of heat resistant molds detected in the enumeration procedure were isolated, codified and stocked. One-month-old spores of each isolate were submitted to different heat shocks to select the most heat resistant mold. The most heat resistant isolated strain (survived 100° C/25 minutes) was identified as Neosartorya fischeri.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The unusual development of branches along the stem of Euterpe edulis is described for the first time. Branches originated at 2 to 190 cm from the ground. Ramified individuals and branches were able to produce reproductive structures and some branches produced roots. A plausible cause for the observed anomaly could be genetic problems due to small population sizes. The better agreement of this process can have a positive effect in the harvest of the heart of palm through the artificial induction of sprouts, what would prevent the death of the individual.
Resumo:
The XX male syndrome - Testicular Disorder of Sexual Differentiation (DSD) is a rare condition characterized by a spectrum of clinical presentations, ranging from ambiguous to normal male genitalia. We report hormonal, molecular and cytogenetic evaluations of a boy presenting with this syndrome. Examination of the genitalia at age of 16 months, showed: penis of 3.5 cm, proximal hypospadia and scrotal testes. Pelvic ultrasound did not demonstrate Mullerian duct structures. Karyotype was 46,XX. Gonadotrophin stimulation test yielded insufficient testosterone production. Gonadal biopsy showed seminiferous tubules without evidence of Leydig cells. Molecular studies revealed that SRY and TSPY genes and also DYZ3 sequences were absent. In addition, the lack of deletions or duplications of SOX9, NR5A1, WNT4 and NROB1 regions was verified. The infant was heterozygous for all microsatellites at the 9p region, including DMRT1 gene, investigated. Only 10% of the patients are SRY-negative and usually they have ambiguous genitalia, as the aforementioned patient. The incomplete masculinization suggests gain of function mutation in one or more genes downstream to SRY gene.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física