61 resultados para específico

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The chemical industries worldwide are passing through a very particular moment of re-adaptation due to the implementation of an European regulation called, Registration, Evaluation, Authorization and Restriction of Chemicals (REACH). In Brazil, the Brazilian Chemical Industry needs urgently a specific guide of chemical products stability. The main purpose of this work is to present a proposal of a guide of stability for chemical products based on the reference guides of the International Conference on Harmonization (ICH). Thus, this work proposes an innovation in terms of methodology which will be useful for shelf life definition purpose for chemical industry products.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this article is to examine the current government proposal of racialization in the Brazilian population, in order to offer support to affirmative action programs that meet the specific needs of those who classify themselves as black. Firstly we focused on the revival of the notion of race among scholars, politicians, and anti-racism activists, as well as on the difficulty in determining who is black in Brazil. Next we examined the racial quota system in the United States and its proclaimed success. Finally, we assessed the extent to which the introduction of racial quota in employment and university enrollment should be imposed as the sole political option for those intending to eliminate racism in Brazilian society.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Remotely sensed imagery has been widely used for land use/cover classification thanks to the periodic data acquisition and the widespread use of digital image processing systems offering a wide range of classification algorithms. The aim of this work was to evaluate some of the most commonly used supervised and unsupervised classification algorithms under different landscape patterns found in Rondônia, including (1) areas of mid-size farms, (2) fish-bone settlements and (3) a gradient of forest and Cerrado (Brazilian savannah). Comparison with a reference map based on the kappa statistics resulted in good to superior indicators (best results - K-means: k=0.68; k=0.77; k=0.64 and MaxVer: k=0.71; k=0.89; k=0.70 respectively for three areas mentioned). Results show that choosing a specific algorithm requires to take into account both its capacity to discriminate among various spectral signatures under different landscape patterns as well as a cost/benefit analysis considering the different steps performed by the operator performing a land cover/use map. it is suggested that a more systematic assessment of several options of implementation of a specific project is needed prior to beginning a land use/cover mapping job.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The post harvest cooling and/or freezing processes for horticultural products have been carried out with the objective of removing the heat from these products, allowing them a bigger period of conservation. Therefore, the knowledge of the physical properties that involve heat transference in the fig fruit Roxo de Valinhos is useful for calculating projects and systems of food engineering in general, as well as, for using in equations of thermodynamic mathematical models. The values of conductivity and thermal diffusivity of the whole fig fruit-rami index were determined, and from these values it was determined the value of the specific heat. For these determination it was used the transient method of the Line Heat Source. The results shown that the fig fruit has a thermal conductivity of 0.52 W m-1°C, thermal diffusivity of 1.56 x 10-7 m² s-1, pulp density of 815.6 kg m-3 and specific heat of 4.07 kJ kg-1 °C.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper aims to identify and analyze the reasons pointed by mothers to prolong breastfeeding beyond the first year of the child s life. The study involved 40 mothers whose children were treated in the Preventive Program of Research and Dental Treatment Center for Special Patients - Dental School of Piracicaba - UNICAMP. The group consisted of mothers who prolonged the breastfeeding beyond the baby s first year of life. All mothers were surveyed by a researcher using a specific questionnaire. In order to avoid information loss, the interviews were taped, then transcripted. Results showed that the main cause of the extended breastfeeding was maternal pleasure. It was also observed that the mother and infant attachment favors prolonged breastfeeding occurrence. Further studies should be carried out for more accurate functional analyses of variable that lead to extend breastfeeding or to wean.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper investigates the relationship between structural and semantic properties of factive sentences and the pattern of extraction exhibited. It is argued that a classification as weak or strong island is unfeasible for what has been termed Factive Island. The kinds of structures allowed as factive complements are analyzed as well as their corresponding behavior concerning extraction. The common feature these structures show is their presuppositional character, which is derived from a selection requirement. I assume that factive predicates select a [+ specific] complement. The differences showed concerning extraction constitute a spontaneous effect from the structural way each construction may satisfy this requirement.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Handball is a sport that demands endurance associated with fast and powerful actions such as jumps, blocks, sprints and throws. The aim of this study was to evaluate the effects of a 38-week systematic physical training applied to a women's under 21 handball team on upper and lower limb power, 30m sprints speed and endurance. The periodization applied was an adaptation of the Verkhoshansky theory, and aimed at two performance peaks during the season with six data collections. The median and range values for three kg medicine ball throwing was: 2.98m (2.15-3.50); 2.84m (2.43-3.20); 2.90m (2.60-3.38); 3.10 (2.83-3.81); 2.84 (2.55-3.57) and 3.34 (2.93-3.83). Regarding the three-pass running test: 5.60m (4.93-6.58); 5.37m (5.04-6.38); 5.36m (4.93-6.12); 5.65m (4.80-6.78); 5.63m (5.00-6.40) and 5.83m (5.14-6.05). Regarding the 30-m sprint test: 5.8m/s (5.45-6.44); 6,64 m/s (6,24-7,09); 5.65m/s (5.17-5.95); (there was not IV moment for this test); 6.19 m/s (5.57-6.26) and 5.83 (5.14-6.05).Regarding the 30-m sprint endurance test until 10% decrease: 4 sprints (4-6); 5 sprints (4-9); 4,5 sprints (4-16); (there was not IV moment for this test); 6 sprints (4-12) and 5 sprints (4-5). Significant differences (p<0.05) were observed in three kg medicine ball throwing and three-pass running tests at least in one of the performance peak planned, with no significant differences in 30-m sprint speed or endurance tests. The applied physical training was efficient at improving the specific physical fitness in the performance peaks, as well as giving support for better physical training adjustment for the upcoming season.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVE: To adapted the critical velocity (CV), RAST test and lactate minimum (LM) to evaluation of female basketball players. METHODS: Twelve well-trained female basketball players (19 ± 1yrs) were submitted to four intensities running (10 - 14 km/h) at shuttle exercise until exhaustion, applied on alternate days. The linear model 'velocity vs. 1/tlim' was adopted to determine the aerobic (CV) and anaerobic (CCA) parameters. The lactate minimum test consisted of two phases: 1) hiperlactatemia induction using the RAST test and 2) incremental test composed by five shuttle run (20-m) at 7, 8, 9, 10, and 12 km/h. Blood samples were collected at the end of each stage. RESULTS: The velocity (vLM) and blood lactate concentration at LM were obtained by two polynomial adjustments: lactate vs. intensity (LM1) and lactate vs. time (LM2). ANOVA one-way, Student t-test and Pearson correlation were used for statistical analysis. The CV was obtained at 10.3 ± 0.2 km/h and the CCA estimated at 73.0 ± 3.4 m. The RAST was capable to induce the hiperlactatemia and to determine the Pmax (3.6 ± 0.2 W/kg), Pmed (2.8 ± 0.1 W/kg), Pmin (2.3 ± 0.1 W/kg) and FI (30 ± 3%). The vLM1 and vLM2 were obtained, respectively, at 9.47 ±0.13 km/h and 9.8 ± 0.13 km/h, and CV was higher than vLM1. CONCLUSION: The results suggest that the non-invasive model can be used to determine the aerobic and anaerobic parameters. Furthermore, the LM test adapted to basketball using RAST and progressive phase was effective to evaluate female athletes considering the specificity of modality, with high success rates observed in polynomial adjustment 'lactate vs. time' (LM2).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física