7 resultados para dry climate events
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Seasonally dry tropical plant formations (SDTF) are likely to exhibit phylogenetic clustering owing to niche conservatism driven by a strong environmental filter (water stress), but heterogeneous edaphic environments and life histories may result in heterogeneity in degree of phylogenetic clustering. We investigated phylogenetic patterns across ecological gradients related to water availability (edaphic environment and climate) in the Caatinga, a SDTF in Brazil. Caatinga is characterized by semiarid climate and three distinct edaphic environments - sedimentary, crystalline, and inselberg -representing a decreasing gradient in soil water availability. We used two measures of phylogenetic diversity: Net Relatedness Index based on the entire phylogeny among species present in a site, reflecting long-term diversification; and Nearest Taxon Index based on the tips of the phylogeny, reflecting more recent diversification. We also evaluated woody species in contrast to herbaceous species. The main climatic variable influencing phylogenetic pattern was precipitation in the driest quarter, particularly for herbaceous species, suggesting that environmental filtering related to minimal periods of precipitation is an important driver of Caatinga biodiversity, as one might expect for a SDTF. Woody species tended to show phylogenetic clustering whereas herbaceous species tended towards phylogenetic overdispersion. We also found phylogenetic clustering in two edaphic environments (sedimentary and crystalline) in contrast to phylogenetic overdispersion in the third (inselberg). We conclude that while niche conservatism is evident in phylogenetic clustering in the Caatinga, this is not a universal pattern likely due to heterogeneity in the degree of realized environmental filtering across edaphic environments. Thus, SDTF, in spite of a strong shared environmental filter, are potentially heterogeneous in phylogenetic structuring. Our results support the need for scientifically informed conservation strategies in the Caatinga and other SDTF regions that have not previously been prioritized for conservation in order to take into account this heterogeneity.
Resumo:
Quantifying global patterns of terrestrial nitrogen (N) cycling is central to predicting future patterns of primary productivity, carbon sequestration, nutrient fluxes to aquatic systems, and climate forcing. With limited direct measures of soil N cycling at the global scale, syntheses of the (15)N:(14)N ratio of soil organic matter across climate gradients provide key insights into understanding global patterns of N cycling. In synthesizing data from over 6000 soil samples, we show strong global relationships among soil N isotopes, mean annual temperature (MAT), mean annual precipitation (MAP), and the concentrations of organic carbon and clay in soil. In both hot ecosystems and dry ecosystems, soil organic matter was more enriched in (15)N than in corresponding cold ecosystems or wet ecosystems. Below a MAT of 9.8°C, soil δ(15)N was invariant with MAT. At the global scale, soil organic C concentrations also declined with increasing MAT and decreasing MAP. After standardizing for variation among mineral soils in soil C and clay concentrations, soil δ(15)N showed no consistent trends across global climate and latitudinal gradients. Our analyses could place new constraints on interpretations of patterns of ecosystem N cycling and global budgets of gaseous N loss.
Resumo:
Trees from tropical montane cloud forest (TMCF) display very dynamic patterns of water use. They are capable of downwards water transport towards the soil during leaf-wetting events, likely a consequence of foliar water uptake (FWU), as well as high rates of night-time transpiration (Enight) during drier nights. These two processes might represent important sources of water losses and gains to the plant, but little is known about the environmental factors controlling these water fluxes. We evaluated how contrasting atmospheric and soil water conditions control diurnal, nocturnal and seasonal dynamics of sap flow in Drimys brasiliensis (Miers), a common Neotropical cloud forest species. We monitored the seasonal variation of soil water content, micrometeorological conditions and sap flow of D. brasiliensis trees in the field during wet and dry seasons. We also conducted a greenhouse experiment exposing D. brasiliensis saplings under contrasting soil water conditions to deuterium-labelled fog water. We found that during the night D. brasiliensis possesses heightened stomatal sensitivity to soil drought and vapour pressure deficit, which reduces night-time water loss. Leaf-wetting events had a strong suppressive effect on tree transpiration (E). Foliar water uptake increased in magnitude with drier soil and during longer leaf-wetting events. The difference between diurnal and nocturnal stomatal behaviour in D. brasiliensis could be attributed to an optimization of carbon gain when leaves are dry, as well as minimization of nocturnal water loss. The leaf-wetting events on the other hand seem important to D. brasiliensis water balance, especially during soil droughts, both by suppressing tree transpiration (E) and as a small additional water supply through FWU. Our results suggest that decreases in leaf-wetting events in TMCF might increase D. brasiliensis water loss and decrease its water gains, which could compromise its ecophysiological performance and survival during dry periods.
Resumo:
A floristic survey was carried out in the Grota Funda Municipal Park, Atibaia Municipality, Sao Paulo State (45º45 - 46º 45'W and 23º10 - 23º15'S), a mountainous region from 900 to 1400 meters above sea level. The climate is characterized by two seasons a hot, moist period from October to March and a dry, cold period from April to August, with frequent frosts. The sandy soil is low in fertility and highly acid at the surface. The study was done from April 1987 to November 1988. A total of 415 species were collected and identified: 362 dicotyledons belonging to 84 families and 224 genera, and 53 monocotyledons beloging to 15 families and 43 genera. Species richness in Atibaia can be attributed to environmental diversity, edaphic variation, and slight disturbance of the vegetation. A comparison with other floristic surveys in mountain forests was made and a list of the most common species of this kind of forest is presented.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
Dry eye disease and ocular surface disorders may be caused or worsened by viral agents. There are several known and suspected virus associated to ocular surface diseases. The possible pathogenic mechanisms for virus-related dry eye disease are presented herein. This review serves to reinforce the importance of ophthalmologists as one of the healthcare professional able to diagnose a potentially large number of infected patients with high prevalent viral agents.